Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00782

HP ID(1) HP00782
Gene ID(2) 5213
Gene Symbol finder PFKM
Protein Name phosphofructokinase, muscle
RefSeq NM_000289.4
Length of RefSeq (bp) 2967
Chromosome 12q13.3
Reference DDBJ accession
UniGene Hs.75160

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS088D13 pGCAP10 GCCTTTCCCAAGGACAATCTGCAAGAAAGCAGCGGCGGAGGAGAGCTAAGACTAAAAGAG
RBb26E02 pGCAP1 GCCCCTTTCCCAAGGACAATTCTGCAAGAAAGCAGCGGCGGAGGAGAGCTAAGACTAAAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl