Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PFKM

Gene ID (NCBI) 5213
Gene Symbol PFKM
Protein Name phosphofructokinase, muscle
Synonyms GSD7|PFK-1|PFK1|PFKA|PFKX
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080778 IRAL001P18 pOTB7 BC000534 NM_000289
HGY080988 IRAL002H20 pOTB7 BC012799 NM_000289 Full
HGY084235 IRAL010J19 pOTB7 BC013298 NM_000289 Full
HGY086831 IRAL017B07 pOTB7 BC021203 NM_000289 Full
HGY088101 IRAL020E05 pOTB7 BC007798 NM_000289 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR235285 ARiS088D13 pGCAP10 NM_000289.4  
GCCTTTCCCAAGGACAATCTGCAAGAAAGCAGCGGCGGAGGAGAGCTAAGACTAAAAGAG
HKR330498 RBb26E02 pGCAP1 NM_000289.4  
GCCCCTTTCCCAAGGACAATTCTGCAAGAAAGCAGCGGCGGAGGAGAGCTAAGACTAAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.12.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl