Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00778

HP ID(1) HP00778
Gene ID(2) 10975
Gene Symbol finder UQCR
Protein Name ubiquinol-cytochrome c reductase (6.4kD) subunit
RefSeq NM_006830.2
Length of RefSeq (bp) 1305
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.8372

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe20E03 pKA1U5 GGGTCAGCTGGACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCC
ARe57E04 pKA1U5 AGATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCACGCTACCGG
ARe65F06 pKA1U5 GATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCACGCTACCGGG
ARi04A12 pGCAP10 TGGGACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCC
ARi20A07 pGCAP10 CGGCCGGCCGATGGGGTCAGCTGGACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATG
ARi21H06 pGCAP10 GACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCACG
ARi25E12 pGCAP10 GATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCACGCTACCGGG
ARi25F09 pGCAP10 GATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCACGCTACCGGG
ARiS045B05 pGCAP10 GAGTGTAGCCGGGTCAGCTGGACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTG
ARiS087G03 pGCAP10 GNNCCNGNNGNNNCNACTCCNCCNNNATGGTGACCCGGTTCCTGGGCCCACGCTACCGGG
ARiS150K20 pGCAP10 GAGTGTAGCCGGGTCAGCTGGACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTG
ARiS194N16 pGCAP10 GGCAGTGTAGCCGGGTCAGCTGGACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGG
RBb04B08 pKA1U5 TGATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCACGCTACCGG
RBb12F05 pKA1U5 GATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCACGCTACCGGG
RBb12G04 pKA1U5 GGCGCAGTGTAGCCGGGTCAGCTGGACAGGGNTCATCCTGAGGGTGCGACTCCGCCGCGA
RBb14G02 pKA1U5 GCTGCGCAGNTGTAGCCGGGTCAGCTGGACAGGGCTCATCCTGAGGGTGCGACTCCGCCG
RBb31F09 pGCAP1 GATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCACGCTACCGGG
RBb53B02 pGCAP1 GATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCACGCTACCGGG
RBd19G02 pGCAP10 GGGACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCA
RBd62H01 pGCAP10 GAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCACGCT
RBd79B04 pGCAP10 GGGGTCAGCTGGACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTC
RBd83A01 pGCAP10 GGCATTGTANCCGGGTCAGCTGGACNGGGTCATCCTGAGGGTGCNACTCCCCCGCGATGG
RBdS013A13 pGCAP10 GGGACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCA
RBdS013C15 pGCAP10 GGGACAGGGTCATCCTNNNGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCA
RBdS015B12 pGCAP10 GAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCACGCT
RBdS081B12 pGCAP10 TGAGTAGCCGGGTCAGCTGGACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTGA
RBdS177A15 pGCAP10 GAGTGTAGCCGGGTCAGCTGGACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTG
RBdS177K05 pGCAP10 GAGTGTAGCCGGGTCAGCTGGACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl