Prev. |  KEGG KO K00420 > 

RIKEN DNA Bank Human Resource - UQCR11

Gene ID NCBI Gene 10975 |  KEGG hsa:10975
Gene Symbol UQCR11
Protein Name ubiquinol-cytochrome c reductase, complex III subunit XI
Synonyms 0710008D09Rik|QCR10|UQCR
Ortholog resources KEGG ortholog (KEGG orthology K00420) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080617 IRAL001J01 pOTB7 BC000462 NM_006830 Full
HGY083842 IRAL009K02 pOTB7 BC003594 NM_006830

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE003621 W01A009A21 pENTR-TOPO IRAL001J01 BC000462 NM_006830  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048099 ARe20E03 pKA1U5 NM_006830.2  
GGGTCAGCTGGACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCC
HKR062900 ARe57E04 pKA1U5 NM_006830.2  
AGATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCACGCTACCGG
HKR066126 ARe65F06 pKA1U5 NM_006830.2  
GATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCACGCTACCGGG
HKR161612 ARi04A12 pGCAP10 NM_006830.2  
TGGGACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCC
HKR168007 ARi20A07 pGCAP10 NM_006830.2  
CGGCCGGCCGATGGGGTCAGCTGGACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATG
HKR168574 ARi21H06 pGCAP10 NM_006830.2  
GACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCACG
HKR170108 ARi25E12 pGCAP10 NM_006830.2  
GATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCACGCTACCGGG
HKR170129 ARi25F09 pGCAP10 NM_006830.2  
GATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCACGCTACCGGG
HKR218029 ARiS045B05 pGCAP10 NM_006830.2  
GAGTGTAGCCGGGTCAGCTGGACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTG
HKR234947 ARiS087G03 pGCAP10 NM_006830.2  
GNNCCNGNNGNNNCNACTCCNCCNNNATGGTGACCCGGTTCCTGGGCCCACGCTACCGGG
HKR260260 ARiS150K20 pGCAP10 NM_006830.2  
GAGTGTAGCCGGGTCAGCTGGACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTG
HKR277928 ARiS194N16 pGCAP10 NM_006830.2  
GGCAGTGTAGCCGGGTCAGCTGGACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGG
HKR321632 RBb04B08 pKA1U5 NM_006830.2  
TGATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCACGCTACCGG
HKR324925 RBb12F05 pKA1U5 NM_006830.2  
GATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCACGCTACCGGG
HKR324948 RBb12G04 pKA1U5 NM_006830.2  
GGCGCAGTGTAGCCGGGTCAGCTGGACAGGGNTCATCCTGAGGGTGCGACTCCGCCGCGA
HKR325746 RBb14G02 pKA1U5 NM_006830.2  
GCTGCGCAGNTGTAGCCGGGTCAGCTGGACAGGGCTCATCCTGAGGGTGCGACTCCGCCG
HKR332529 RBb31F09 pGCAP1 NM_006830.2  
GATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCACGCTACCGGG
HKR341226 RBb53B02 pGCAP1 NM_006830.2  
GATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCACGCTACCGGG
HKR367746 RBd19G02 pGCAP10 NM_006830.2  
GGGACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCA
HKR384969 RBd62H01 pGCAP10 NM_006830.2  
GAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCACGCT
HKR391628 RBd79B04 pGCAP10 NM_006830.2  
GGGGTCAGCTGGACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTC
HKR393201 RBd83A01 pGCAP10 NM_006830.2  
GGCATTGTANCCGGGTCAGCTGGACNGGGTCATCCTGAGGGTGCNACTCCCCCGCGATGG
HKR405213 RBdS013A13 pGCAP10 NM_006830.2  
GGGACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCA
HKR405263 RBdS013C15 pGCAP10 NM_006830.2  
GGGACAGGGTCATCCTNNNGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCA
HKR406036 RBdS015B12 pGCAP10 NM_006830.2  
GAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTGACCCGGTTCCTGGGCCCACGCT
HKR432436 RBdS081B12 pGCAP10 NM_006830.2  
TGAGTAGCCGGGTCAGCTGGACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTGA
HKR470815 RBdS177A15 pGCAP10 NM_006830.2  
GAGTGTAGCCGGGTCAGCTGGACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTG
HKR471045 RBdS177K05 pGCAP10 NM_006830.2  
GAGTGTAGCCGGGTCAGCTGGACAGGGTCATCCTGAGGGTGCGACTCCGCCGCGATGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl