Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00756

HP ID(1) HP00756
Gene ID(2) 3875
Gene Symbol finder KRT18
Protein Name keratin 18
RefSeq NM_000224.2
Length of RefSeq (bp) 1485
Chromosome 12q13
Reference DDBJ accession
UniGene Hs.406013

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe13F04 pKA1U5 GGCCACCGNTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATGAG
ARe19A02 pKA1U5 GGCCGCCACCGNTCGTCCGCAAAGCCTGAGTCCTGTTCCTTTCTCTCTCCCCGGACAGCA
ARe29E06 pKA1U5 GGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATG
ARe32G11 pKA1U5 GGCCGCCACCGNTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCAT
ARe34C04 pKA1U5 GGGCCGCCACCGNTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCA
ARe35C09 pKA1U5 GGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGCTCCTTTCTCTCTCCCCGGACAGCAT
ARe36A05 pKA1U5 GGCCGCCACCGNTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCAT
ARe48B03 pKA1U5 GGGCCGCCACCGNTCGTCCGCAAAGCCTGAGATCCTGTCCTTTCTCTCTCCCCGGACAGC
ARe49B11 pKA1U5 GGCCACCGNTCGNTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATGA
ARe60C01 pKA1U5 GGGCCGCCACCGNTCGTCCGCAAAGCCTGAGTCCTGNTCCTTTCTCTCTCCCCGGACAGC
ARe60G05 pKA1U5 GAGGCCGCCACCGNTCGNTCCGCAAAGCCTGAGTCCTGTTCCTTTCTCTCTCCCCGGACA
ARe68A03 pKA1U5 GAGGCCGCCACCGNTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGC
ARe80A01 pKA1U5 ATCCTGGCTTTTCTCTCTCCCCGGACAGCATGAGCTTCACCACTCGCTCCACCTTCTCCA
ARe81E07 pKA1U5 GGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATG
ARe94F09 pKA1U5 ATCCTGGGCCACCGNTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAG
ARe97F08 pKA1U5 GGGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCAT
ARf03B09 pKA1U5 GGGCCGCCACCGNTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCA
ARf04B06 pKA1U5 GGCCACCGNTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATGAG
ARf07C08 pKA1U5 GGGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCAT
ARf07E12 pKA1U5 GGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGCTCNTTTCTCTCTCCCCGGACAGCAT
ARi22G06 pGCAP10 GGCCGCCGCCGTCGTCCCCCCCCCTGACTCCTGTCCTTTCTCTCTCCCCGGACAGCATGA
ARi25E04 pGCAP10 GGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATG
ARi30C01 pGCAP10 GGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATGAGC
ARi33B03 pGCAP10 GGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATG
ARi33F02 pGCAP10 GACTCTGCGATATAACTCGGGTCGCGCGGCTCGCGCAGGCCGCCACCGTCGTCCGCAAAG
ARi44E03 pGCAP10 GCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATGAG
ARi48B03 pGCAP10 GTCTCTCTCCCCGGACAGCATGAGCTTCACCACTCGCTCCACCTTCTCCACCAACTACCG
ARi53E10 pGCAP10 GAGGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCA
ARi57D07 pGCAP10 GGGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCAT
ARi58A10 pGCAP10 GAGGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCA
ARi65G01 pGCAP10 GGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATGAGC
ARi67D01 pGCAP10 ATTGGGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCAT
ARi67F08 pGCAP10 GAGGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCA
ARi70B07 pGCAP10 GCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATGAG
ARiS008L07 pGCAP10 GGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATGAGC
ARiS020F04 pGCAP10 GGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATG
ARiS085I24 pGCAP10 GGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATGAGC
ARiS087L03 pGCAP10 GGCCACCGTCTTCCNCAAANCCTGANTCCTGTCCTTTCTCTCTCCCCGGACAGCATGAGC
ARiS088H14 pGCAP10 GCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATGAGCT
ARiS122I19 pGCAP10 GGAAAGCANCCTCGAGGGCCAACAACACCTGCTGTCCGTGTCCATGCCCGGTTGGCCACC
ARiS150B11 pGCAP10 GGCCACCGNCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATGAGC
ARiS191L05 pGCAP10 GAGGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCA
ARiS191P02 pGCAP10 GGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATG
ARiS194M22 pGCAP10 GNCCGCCNCCNTNNTNCGNANANNCTGATTCCTGTNNTTTCTCTCTCCCCGGACNGCATG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl