Prev. |  KEGG KO K07604 > 

RIKEN DNA Bank Human Resource - KRT18

Gene ID NCBI Gene 3875 |  KEGG hsa:3875
Gene Symbol KRT18
Protein Name keratin 18
Synonyms CK-18|CYK18|K18
Ortholog resources KEGG ortholog (KEGG orthology K07604) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001229 IRAK003B05 pCMV-SPORT6 BC000180 NM_199187 Full
HGX004847 IRAK012B23 pCMV-SPORT6 BC008636 NM_199187 Full
HGX008300 IRAK020M12 pCMV-SPORT6 BC020982 NM_199187 Full
HGY082330 IRAL005N18 pOTB7 BC000698 NM_199187 Full/var
HGY085314 IRAL013E18 pOTB7 BC004253 NM_199187 Full
HGY085883 IRAL014L19 pOTB7 BC009754 NM_199187 Partial
HGY103434 IRAL058J18 pOTB7 BC072017 NM_199187 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE107225 M01C068B01 pDONR221 06_08-G01 BC000698 NM_199187  
HGE107273 M01C068D01 pDONR221 06_08-G01 BC000698 NM_199187  
HGE107321 M01C068F01 pDONR221 06_08-G01 BC000698 NM_199187  
HGE107369 M01C068H01 pDONR221 06_08-G01 BC000698 NM_199187  
HGE107417 M01C068J01 pDONR221 06_08-G01 BC000698 NM_199187  
HGE107465 M01C068L01 pDONR221 06_08-G01 BC000698 NM_199187  
HGE107513 M01C068N01 pDONR221 06_08-G01 BC000698 NM_199187  
HGE107561 M01C068P01 pDONR221 06_08-G01 BC000698 NM_199187  
HGE124808 M01C112A08 pDONR221 06-2_04-F04 BC000698 NM_199187  
HGE124856 M01C112C08 pDONR221 06-2_04-F04 BC000698 NM_199187  
HGE124904 M01C112E08 pDONR221 06-2_04-F04 BC000698 NM_199187  
HGE124952 M01C112G08 pDONR221 06-2_04-F04 BC000698 NM_199187  
HGE125000 M01C112I08 pDONR221 06-2_04-F04 BC000698 NM_199187  
HGE125048 M01C112K08 pDONR221 06-2_04-F04 BC000698 NM_199187  
HGE125096 M01C112M08 pDONR221 06-2_04-F04 BC000698 NM_199187  
HGE125144 M01C112O08 pDONR221 06-2_04-F04 BC000698 NM_199187  
HGE085647 M01C014B23 pDONR221 FLJ04-G12 AK129587 NM_199187  
HGE085695 M01C014D23 pDONR221 FLJ04-G12 AK129587 NM_199187  
HGE085743 M01C014F23 pDONR221 FLJ04-G12 AK129587 NM_199187  
HGE085791 M01C014H23 pDONR221 FLJ04-G12 AK129587 NM_199187  
HGE085839 M01C014J23 pDONR221 FLJ04-G12 AK129587 NM_199187  
HGE085887 M01C014L23 pDONR221 FLJ04-G12 AK129587 NM_199187  
HGE085935 M01C014N23 pDONR221 FLJ04-G12 AK129587 NM_199187  
HGE085983 M01C014P23 pDONR221 FLJ04-G12 AK129587 NM_199187  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_210404.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045324 ARe13F04 pKA1U5 NM_000224.2  
GGCCACCGNTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATGAG
HKR047602 ARe19A02 pKA1U5 NM_000224.2  
GGCCGCCACCGNTCGTCCGCAAAGCCTGAGTCCTGTTCCTTTCTCTCTCCCCGGACAGCA
HKR051702 ARe29E06 pKA1U5 NM_000224.2  
GGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATG
HKR052955 ARe32G11 pKA1U5 NM_000224.2  
GGCCGCCACCGNTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCAT
HKR053652 ARe34C04 pKA1U5 NM_000224.2  
GGGCCGCCACCGNTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCA
HKR054057 ARe35C09 pKA1U5 NM_000224.2  
GGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGCTCCTTTCTCTCTCCCCGGACAGCAT
HKR054405 ARe36A05 pKA1U5 NM_000224.2  
GGCCGCCACCGNTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCAT
HKR059227 ARe48B03 pKA1U5 NM_000224.2  
GGGCCGCCACCGNTCGTCCGCAAAGCCTGAGATCCTGTCCTTTCTCTCTCCCCGGACAGC
HKR059635 ARe49B11 pKA1U5 NM_000224.2  
GGCCACCGNTCGNTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATGA
HKR064049 ARe60C01 pKA1U5 NM_000224.2  
GGGCCGCCACCGNTCGTCCGCAAAGCCTGAGTCCTGNTCCTTTCTCTCTCCCCGGACAGC
HKR064149 ARe60G05 pKA1U5 NM_000224.2  
GAGGCCGCCACCGNTCGNTCCGCAAAGCCTGAGTCCTGTTCCTTTCTCTCTCCCCGGACA
HKR067203 ARe68A03 pKA1U5 NM_000224.2  
GAGGCCGCCACCGNTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGC
HKR072503 ARe81E07 pKA1U5 NM_000224.2  
GGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATG
HKR077729 ARe94F09 pKA1U5 NM_000224.2  
ATCCTGGGCCACCGNTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAG
HKR078928 ARe97F08 pKA1U5 NM_000224.2  
GGGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCAT
HKR081233 ARf03B09 pKA1U5 NM_000224.2  
GGGCCGCCACCGNTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCA
HKR081630 ARf04B06 pKA1U5 NM_000224.2  
GGCCACCGNTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATGAG
HKR082856 ARf07C08 pKA1U5 NM_000224.2  
GGGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCAT
HKR168950 ARi22G06 pGCAP10 NM_000224.2  
GGCCGCCGCCGTCGTCCCCCCCCCTGACTCCTGTCCTTTCTCTCTCCCCGGACAGCATGA
HKR170100 ARi25E04 pGCAP10 NM_000224.2  
GGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATG
HKR172049 ARi30C01 pGCAP10 NM_000224.2  
GGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATGAGC
HKR173227 ARi33B03 pGCAP10 NM_000224.2  
GGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATG
HKR173322 ARi33F02 pGCAP10 NM_000224.2  
GACTCTGCGATATAACTCGGGTCGCGCGGCTCGCGCAGGCCGCCACCGTCGTCCGCAAAG
HKR177699 ARi44E03 pGCAP10 NM_000224.2  
GCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATGAG
HKR179227 ARi48B03 pGCAP10 NM_000224.2  
GTCTCTCTCCCCGGACAGCATGAGCTTCACCACTCGCTCCACCTTCTCCACCAACTACCG
HKR181306 ARi53E10 pGCAP10 NM_000224.2  
GAGGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCA
HKR182879 ARi57D07 pGCAP10 NM_000224.2  
GGGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCAT
HKR183210 ARi58A10 pGCAP10 NM_000224.2  
GAGGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCA
HKR186145 ARi65G01 pGCAP10 NM_000224.2  
GGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATGAGC
HKR186873 ARi67D01 pGCAP10 NM_000224.2  
ATTGGGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCAT
HKR186928 ARi67F08 pGCAP10 NM_000224.2  
GAGGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCA
HKR188031 ARi70B07 pGCAP10 NM_000224.2  
GCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATGAG
HKR203471 ARiS008L07 pGCAP10 NM_000224.2  
GGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATGAGC
HKR208124 ARiS020F04 pGCAP10 NM_000224.2  
GGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATG
HKR234216 ARiS085I24 pGCAP10 NM_000224.2  
GGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATGAGC
HKR235067 ARiS087L03 pGCAP10 NM_000224.2  
GGCCACCGTCTTCCNCAAANCCTGANTCCTGTCCTTTCTCTCTCCCCGGACAGCATGAGC
HKR235382 ARiS088H14 pGCAP10 NM_000224.2  
GCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATGAGCT
HKR249011 ARiS122I19 pGCAP10 NM_000224.2  
GGAAAGCANCCTCGAGGGCCAACAACACCTGCTGTCCGTGTCCATGCCCGGTTGGCCACC
HKR260035 ARiS150B11 pGCAP10 NM_000224.2  
GGCCACCGNCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATGAGC
HKR276669 ARiS191L05 pGCAP10 NM_000224.2  
GAGGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCA
HKR276762 ARiS191P02 pGCAP10 NM_000224.2  
GGCCGCCACCGTCGTCCGCAAAGCCTGAGTCCTGTCCTTTCTCTCTCCCCGGACAGCATG
HKR277910 ARiS194M22 pGCAP10 NM_000224.2  
GNCCGCCNCCNTNNTNCGNANANNCTGATTCCTGTNNTTTCTCTCTCCCCGGACNGCATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl