Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00749

HP ID(1) HP00749
Gene ID(2) 7332
Gene Symbol finder UBE2L3
Protein Name ubiquitin-conjugating enzyme E2L 3
RefSeq NM_003347.2
Length of RefSeq (bp) 2907
Chromosome 22q11.21
Reference DDBJ accession
UniGene Hs.108104

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARf07D03 pKA1U5 ACCAAATCCAAGATGGCGGCCAGCAGGAGGCTGATGAAGGAGCTTGAAGAAATCCGCAAA
ARi54C10 pGCAP10 GACCAAATCCAAGATGGCGGCCAGCAGGAGGCTGATGAAGGAGCTTGAAGAAATCCGCAA
ARiS096K06 pGCAP10 GGGGGAAGGAGCAGCACCAAATCCAAGATGGCGGCCAGCAGGAGGCTGATGAAGGAGCTT
RBdS015D02 pGCAP10 GATTCTGGGGAAGGAGCAGCACCAAATCCAAGATGGCGGCCAGCAGGAGGCTGATGAAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl