Prev. |  KEGG KO K04552 > 

RIKEN DNA Bank Human Resource - UBE2L3

Gene ID NCBI Gene 7332 |  KEGG hsa:7332
Gene Symbol UBE2L3
Protein Name ubiquitin conjugating enzyme E2 L3
Synonyms E2-F1|L-UBC|UBCH7|UbcM4
Ortholog resources KEGG ortholog (KEGG orthology K04552) in the DNA Bank
Featured content Parkinson disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX046014 IRAK115A14 pCMV-SPORT6 BC053368 NM_003347 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE095607 M01C039A07 pDONR221 MGC09-A04 BC053368 NM_198157  
HGE095655 M01C039C07 pDONR221 MGC09-A04 BC053368 NM_198157  
HGE095703 M01C039E07 pDONR221 MGC09-A04 BC053368 NM_198157  
HGE095751 M01C039G07 pDONR221 MGC09-A04 BC053368 NM_198157  
HGE095799 M01C039I07 pDONR221 MGC09-A04 BC053368 NM_198157  
HGE095847 M01C039K07 pDONR221 MGC09-A04 BC053368 NM_198157  
HGE095895 M01C039M07 pDONR221 MGC09-A04 BC053368 NM_198157  
HGE095943 M01C039O07 pDONR221 MGC09-A04 BC053368 NM_198157  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR082875 ARf07D03 pKA1U5 NM_003347.2  
ACCAAATCCAAGATGGCGGCCAGCAGGAGGCTGATGAAGGAGCTTGAAGAAATCCGCAAA
HKR181658 ARi54C10 pGCAP10 NM_003347.2  
GACCAAATCCAAGATGGCGGCCAGCAGGAGGCTGATGAAGGAGCTTGAAGAAATCCGCAA
HKR238646 ARiS096K06 pGCAP10 NM_003347.2  
GGGGGAAGGAGCAGCACCAAATCCAAGATGGCGGCCAGCAGGAGGCTGATGAAGGAGCTT
HKR406074 RBdS015D02 pGCAP10 NM_003347.2  
GATTCTGGGGAAGGAGCAGCACCAAATCCAAGATGGCGGCCAGCAGGAGGCTGATGAAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl