Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00744

HP ID(1) HP00744
Gene ID(2) 7415
Gene Symbol finder VCP
Protein Name valosin-containing protein
RefSeq NM_007126.3
Length of RefSeq (bp) 3859
Chromosome 9p13.3
Reference DDBJ accession
UniGene Hs.529782

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARf03A06 pKA1U5 GGCTCAGTCTCAGCGAAGCGTCTGCGACCGTCGTTTGAGTCGTCGCTGCCGCTGCCGCTG
ARi33F09 pGCAP10 GCTCGGCTCAGTCTCAGCGAAGCGTCTGCGACCGTCGTTTGAGTCGTCGCTGCCGCTGCC
ARi53F10 pGCAP10 CAGCCGGCCGATGGTCTGCGACCGTCGTTTGAGTCGTCGCTGCCGCTGCCGCTGCCACTN
ARiS191C17 pGCAP10 GGTTTTGAGTCGTCGCTGCCGCTGCCGCTGCCACTGCCACTGCCACCTCGCGGATCAGGA
RBb33D08 pGCAP1 GGCCACTGCCACTGCCACCTCGCGGATCAGGAGCCAGCGTTGTTCGCCCGACGCCTCGCT
RBd43E06 pGCAP10 GTCAGTCTCAGCGAAGCGTCTGCGACCGTCGTTTGAGTCGTCGCTGCCGCTGCCGCTGCC
RBdS081N08 pGCAP10 AAGGGGAAGCCGCTTGCGGGTTTGTCGCCGCTGCTCGCCCACCGCCTGGAAGAGCCGAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl