Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00743

HP ID(1) HP00743
Gene ID(2) 7076
Gene Symbol finder TIMP1
Protein Name TIMP metallopeptidase inhibitor 1
RefSeq NM_003254.2
Length of RefSeq (bp) 931
Chromosome Xp11.3-p11.23
Reference DDBJ accession
UniGene Hs.522632

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe05H07 pKA1U5 GGTGGACATTTATCCTCTAGCGCTCAGGCCCTGCCGCCATCGCCGCAGATCCAGCGCCCA
ARiS008A14 pGCAP10 GGCCATCGCCGCAGATCCAGCGCCCAGAGAGACACCAGAGAACCCACCATGGCCCCCTTT
ARiS023L16 pGCAP10 GAGCGTGGACATTTATCCTCTAGCGCTCAGGCCCTGCCGCCATCGCCGCAGATCCAGCGC
ARiS049B16 pGCAP10 GGGACATTTATCCTCTAGCGCTCAGGCCCTGCCGCCATCGCCGCAGATCCAGCGCCCAGA
ARiS150C07 pGCAP10 GATCCAGGAAGCCTGGAGGCCTGTGGTTTCCGCACCCGCTGCCACCCCCGCCCCTAGCGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl