Prev. |  KEGG KO K16451 > 

RIKEN DNA Bank Human Resource - TIMP1

Gene ID NCBI Gene 7076 |  KEGG hsa:7076
Gene Symbol TIMP1
Protein Name TIMP metallopeptidase inhibitor 1
Synonyms CLGI|EPA|EPO|HCI|TIMP|TIMP-1
Featured content HIF-1 signaling pathway - human
Ortholog resource in our bank

  TIMP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03509 pAxCALNLhTIMP1 (forward) Shuttle vector to generate rAd harboring human TIMP1 (forward)
RDB03514 pAxCALNLhTIMP1 (forward) Shuttle vector to generate rAd harboring human TIMP1 (forward)
RDB03517 pAxCALNLhTIMP1 (forward) Shuttle vector to generate rAd harboring human TIMP1 (forward)
RDB04092 pAxCALNLhTIMP1 (reverse) Shuttle vector to generate rAd harboring human TIMP1 (reverse)
RDB04097 pAxCALNLhTIMP1 (reverse) Shuttle vector to generate rAd harboring human TIMP1 (reverse)
RDB04100 pAxCALNLhTIMP1 (reverse) Shuttle vector to generate rAd harboring human TIMP1
RDB05431 pAxCALNLhTIMP1 (forward) Shuttle vector to generate rAd harboring human TIMP1 (forward)
RDB05432 pAxCALNLhTIMP1 (reverse) Shuttle vector to generate rAd harboring human TIMP1 (reverse)
RDB07516 pGL4-phTIMP1 Promoter collection, Human TIMP1 promoter

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001622 IRAK004A22 pCMV-SPORT6 BC000866 NM_003254 Full
HGY088558 IRAL021G14 pDNR-LIB BC007097 NM_003254 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042175 ARe05H07 pKA1U5 NM_003254.2  
GGTGGACATTTATCCTCTAGCGCTCAGGCCCTGCCGCCATCGCCGCAGATCCAGCGCCCA
HKR203214 ARiS008A14 pGCAP10 NM_003254.2  
GGCCATCGCCGCAGATCCAGCGCCCAGAGAGACACCAGAGAACCCACCATGGCCCCCTTT
HKR209480 ARiS023L16 pGCAP10 NM_003254.2  
GAGCGTGGACATTTATCCTCTAGCGCTCAGGCCCTGCCGCCATCGCCGCAGATCCAGCGC
HKR219640 ARiS049B16 pGCAP10 NM_003254.2  
GGGACATTTATCCTCTAGCGCTCAGGCCCTGCCGCCATCGCCGCAGATCCAGCGCCCAGA
HKR260055 ARiS150C07 pGCAP10 NM_003254.2  
GATCCAGGAAGCCTGGAGGCCTGTGGTTTCCGCACCCGCTGCCACCCCCGCCCCTAGCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl