Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00730

HP ID(1) HP00730
Gene ID(2) 5689
Gene Symbol finder PSMB1
Protein Name proteasome (prosome, macropain) subunit, beta type, 1
RefSeq NM_002793.3
Length of RefSeq (bp) 938
Chromosome 6q27
Reference DDBJ accession
UniGene Hs.352768

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe12E07 pKA1U5 GGGTCAAGGCAGCCATCTCGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGCCGTG
ARe17G03 pKA1U5 GGGATCCGCAGGCGCAGCCGTGCGATGTTGTCCTCTACAGCCATGTATTCGGCTCCTGGC
ARe31H05 pKA1U5 GAAGTGTCGGATCCGCAGGCGCAGCCGTGCGATGTTGTCCTCTACAGCCATGTATTCGGC
ARe40E11 pKA1U5 GGCCGTGCGATGTTGTCCTCTACAGCCATGNTATTCGGCTCCTGGCAGAGACTTGGGGAT
ARe66G07 pKA1U5 GGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGCCGTGCGATGTTGTCCTCTACAG
ARi33F12 pGCAP10 GGGTCAAGGCAGCCATCTCGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGCCGTG
ARi59G12 pGCAP10 GGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGCCGTGCGATGTTGTCCTCTACAG
ARi60A05 pGCAP10 GAGCCATCTCGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGCCGTGCGATGTTGT
ARiS118K22 pGCAP10 GAGCCATCTCGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGCCGTGCGATGTTGT
ARiS194H16 pGCAP10 GCCGGTCNANGCANCCATCTCGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGCCG
RBb05B01 pKA1U5 GGTCCGGTCAAGGCAGCCATCTCGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGC
RBb09A03 pKA1U5 GCGGTCAAGGCAGCCATCTCGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGCCGT
RBd33G09 pGCAP10 GAGCCATCTCGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGCCGTGCGATGTTGT
RBd54B01 pGCAP10 GGCTCCAGCCGTGCNANGTTGGCCTCNACANNCATGTNTNCGGCTGCTGGCCNACACTTG
RBdS083B15 pGCAP10 GGCAGCCGTGCGATGTTGTCCTCTACAGCCATGTATTCGGCTGCTGGCAGAGACTTGGGG
RBdS105P10 pGCAP10 GCAAGGCAGCCATCTCGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGCCGTGCGA
RBdS110G03 pGCAP10 GNGAGACNGCNNGTNTCNNATCNNNNGNNNCAGCCGTGCGATGTTGTCCTCTACAGCCAT
RBdS132O03 pGCAP10 GAAGGCAGCCATCTCGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGCCGTGCGAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl