Prev. |  KEGG KO K02732 > 

RIKEN DNA Bank Human Resource - PSMB1

Gene ID NCBI Gene 5689 |  KEGG hsa:5689
Gene Symbol PSMB1
Protein Name proteasome subunit beta 1
Synonyms HC5|PMSB1|PSC5
Ortholog resources KEGG ortholog (KEGG orthology K02732) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080584 IRAL001H16 pOTB7 BC000508 NM_002793 Full/var
HGY094273 IRAL035L09 pDNR-LIB BC020807 NM_002793 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE019420 W01A048J04 pENTR-TOPO IRAL035L09 BC020807 NM_002793  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044903 ARe12E07 pKA1U5 NM_002793.3  
GGGTCAAGGCAGCCATCTCGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGCCGTG
HKR046947 ARe17G03 pKA1U5 NM_002793.3  
GGGATCCGCAGGCGCAGCCGTGCGATGTTGTCCTCTACAGCCATGTATTCGGCTCCTGGC
HKR052573 ARe31H05 pKA1U5 NM_002793.3  
GAAGTGTCGGATCCGCAGGCGCAGCCGTGCGATGTTGTCCTCTACAGCCATGTATTCGGC
HKR056107 ARe40E11 pKA1U5 NM_002793.3  
GGCCGTGCGATGTTGTCCTCTACAGCCATGNTATTCGGCTCCTGGCAGAGACTTGGGGAT
HKR066551 ARe66G07 pKA1U5 NM_002793.3  
GGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGCCGTGCGATGTTGTCCTCTACAG
HKR173332 ARi33F12 pGCAP10 NM_002793.3  
GGGTCAAGGCAGCCATCTCGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGCCGTG
HKR183756 ARi59G12 pGCAP10 NM_002793.3  
GGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGCCGTGCGATGTTGTCCTCTACAG
HKR184005 ARi60A05 pGCAP10 NM_002793.3  
GAGCCATCTCGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGCCGTGCGATGTTGT
HKR247462 ARiS118K22 pGCAP10 NM_002793.3  
GAGCCATCTCGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGCCGTGCGATGTTGT
HKR277784 ARiS194H16 pGCAP10 NM_002793.3  
GCCGGTCNANGCANCCATCTCGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGCCG
HKR322025 RBb05B01 pKA1U5 NM_002793.3  
GGTCCGGTCAAGGCAGCCATCTCGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGC
HKR323603 RBb09A03 pKA1U5 NM_002793.3  
GCGGTCAAGGCAGCCATCTCGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGCCGT
HKR373353 RBd33G09 pGCAP10 NM_002793.3  
GAGCCATCTCGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGCCGTGCGATGTTGT
HKR381625 RBd54B01 pGCAP10 NM_002793.3  
GGCTCCAGCCGTGCNANGTTGGCCTCNACANNCATGTNTNCGGCTGCTGGCCNACACTTG
HKR433239 RBdS083B15 pGCAP10 NM_002793.3  
GGCAGCCGTGCGATGTTGTCCTCTACAGCCATGTATTCGGCTGCTGGCAGAGACTTGGGG
HKR442370 RBdS105P10 pGCAP10 NM_002793.3  
GCAAGGCAGCCATCTCGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGCCGTGCGA
HKR444147 RBdS110G03 pGCAP10 NM_002793.3  
GNGAGACNGCNNGTNTCNNATCNNNNGNNNCAGCCGTGCGATGTTGTCCTCTACAGCCAT
HKR453139 RBdS132O03 pGCAP10 NM_002793.3  
GAAGGCAGCCATCTCGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGCCGTGCGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl