Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00729

HP ID(1) HP00729
Gene ID(2) 27089
Gene Symbol finder UQCRQ
Protein Name ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa
RefSeq NM_014402.4
Length of RefSeq (bp) 1585
Chromosome 5q31.1
Reference DDBJ accession
UniGene Hs.146602

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe23D09 pKA1U5 GGAACGAGTCAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCACA
ARe63H09 pKA1U5 GAGTCAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCACAATGGG
ARe87C08 pKA1U5 GGAAATGACGAACGAGTCAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCG
ARe93E04 pKA1U5 GGAGTCAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCACAATGG
ARf04F01 pKA1U5 GGAACGAGTCAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCACA
ARi23G07 pGCAP10 GAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCACAATGGGCCGC
ARi35C11 pGCAP10 CGGCCGGCCGATGGGAAATGACGAACGAGTCAACCGGATCGGTGACTGTGGAGGGCGAGC
ARi55D06 pGCAP10 GGAGTCAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCACAATGG
ARiS023L08 pGCAP10 GGAGTCAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCACAATGG
ARiS045O11 pGCAP10 GGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCACAATGGGCCGCGAGTTTGGGAAT
RBb03C07 pKA1U5 TGGAACGAGTCAACCGGATCGGTGACTGGTGGAGNGNTTAGCATGAGCCCTGGCCGCCGC
RBb07E06 pKA1U5 GGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGNCCGCCGCCACAATGGGCCGCGAGT
RBd11D03 pGCAP10 TGGACGAACGAGTCAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGC
RBd12G06 pGCAP10 GGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCACAATGGGCCGCGAGTTTGGGA
RBd36F03 pGCAP10 GGAGTCAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCACAATGG
RBd40A10 pGCAP10 GCGGAAATGACGAACGAGTCAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGC
RBd45D03 pGCAP10 GGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCACAATGGGCCGCGAGTTTGGGAAT
RBd47D11 pGCAP10 GACGAACGAGTCAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCA
RBdS070E01 pGCAP10 ACGAACGAGTCAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCAC
RBdS154H18 pGCAP10 GGACCAACNAGTCAACCNNNTCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCC
RBdS177E07 pGCAP10 GAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCACAATGGGCCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl