Prev. |  KEGG KO K00418 > 

RIKEN DNA Bank Human Resource - UQCRQ

Gene ID NCBI Gene 27089 |  KEGG hsa:27089
Gene Symbol UQCRQ
Protein Name ubiquinol-cytochrome c reductase complex III subunit VII
Synonyms MC3DN4|QCR8|QP-C|QPC|UQCR7
Ortholog resources KEGG ortholog (KEGG orthology K00418) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081891 IRAL004M03 pOTB7 BC001390 NM_014402 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049281 ARe23D09 pKA1U5 NM_014402.4  
GGAACGAGTCAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCACA
HKR065377 ARe63H09 pKA1U5 NM_014402.4  
GAGTCAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCACAATGGG
HKR074856 ARe87C08 pKA1U5 NM_014402.4  
GGAAATGACGAACGAGTCAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCG
HKR077300 ARe93E04 pKA1U5 NM_014402.4  
GGAGTCAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCACAATGG
HKR081721 ARf04F01 pKA1U5 NM_014402.4  
GGAACGAGTCAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCACA
HKR169351 ARi23G07 pGCAP10 NM_014402.4  
GAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCACAATGGGCCGC
HKR174059 ARi35C11 pGCAP10 NM_014402.4  
CGGCCGGCCGATGGGAAATGACGAACGAGTCAACCGGATCGGTGACTGTGGAGGGCGAGC
HKR182078 ARi55D06 pGCAP10 NM_014402.4  
GGAGTCAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCACAATGG
HKR209472 ARiS023L08 pGCAP10 NM_014402.4  
GGAGTCAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCACAATGG
HKR218347 ARiS045O11 pGCAP10 NM_014402.4  
GGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCACAATGGGCCGCGAGTTTGGGAAT
HKR321255 RBb03C07 pKA1U5 NM_014402.4  
TGGAACGAGTCAACCGGATCGGTGACTGGTGGAGNGNTTAGCATGAGCCCTGGCCGCCGC
HKR322902 RBb07E06 pKA1U5 NM_014402.4  
GGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGNCCGCCGCCACAATGGGCCGCGAGT
HKR364475 RBd11D03 pGCAP10 NM_014402.4  
TGGACGAACGAGTCAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGC
HKR364950 RBd12G06 pGCAP10 NM_014402.4  
GGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCACAATGGGCCGCGAGTTTGGGA
HKR374523 RBd36F03 pGCAP10 NM_014402.4  
GGAGTCAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCACAATGG
HKR376010 RBd40A10 pGCAP10 NM_014402.4  
GCGGAAATGACGAACGAGTCAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGC
HKR378075 RBd45D03 pGCAP10 NM_014402.4  
GGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCACAATGGGCCGCGAGTTTGGGAAT
HKR378883 RBd47D11 pGCAP10 NM_014402.4  
GACGAACGAGTCAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCA
HKR428097 RBdS070E01 pGCAP10 NM_014402.4  
ACGAACGAGTCAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCAC
HKR461786 RBdS154H18 pGCAP10 NM_014402.4  
GGACCAACNAGTCAACCNNNTCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCC
HKR470903 RBdS177E07 pGCAP10 NM_014402.4  
GAACCGGATCGGTGACTGTGGAGGGCGAGCTGAGCCCTGGCCGCCGCCACAATGGGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl