Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00721

HP ID(1) HP00721
Gene ID(2) 5439
Gene Symbol finder POLR2J
Protein Name polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa
RefSeq NM_006234.4
Length of RefSeq (bp) 991
Chromosome 7q22.1
Reference DDBJ accession
UniGene Hs.654952

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe03A04 pKA1U5 GCTCTTATTAGGGCTCTGGTGGCGGCGGCGGCGGACCCTTGGGGTCTGGACGCGACGGCG
ARe84H11 pKA1U5 GGGACCCTTGGGGTCTGGACGCNACGGCGGCCGGTGAATGAACGCCCCATCCAGCCGTTC
ARi62G11 pGCAP10 GATTAGGGCTCTGGTGGCGGCGGTGGCGGACACTTGGGGTCTGGACGCAACGGCGGCGGG
ARi70C10 pGCAP10 GAGAGGCCTCTTATTAGGGCTCTGGTGGCGGCGGCGGCGGACCCTTGGGGTCTGGACGCG
ARiS118L22 pGCAP10 GGACACTTGGGGTCTGGACGCAACGGCGGCGGGAGCATGAACGCCCCTCCAGCCTTCGAG
RBb57A03 pGCAP1 GGGACCCTTGGGGTCTGGACGCGACGGCGGCGGGAGCATGAACGCCCCTCCAGCCTTCGA
RBd27C12 pGCAP10 GATTAGGGCTCTGGTGGCGGCGGTGGCGGACACTTGGGGTCTGGACGCAACGGCGGCGGG
RBd65E05 pGCAP10 GACTTGGGGTCTGGACGCAACGGCGGCGGGAGCATGAACGCCCCTCCAGCCTTCGAGTCG
RBdS013A11 pGCAP10 GGGTGGCGGCGGCGGCGGACCCTTGGGGTCTGGACGCGACGGCGGCGGGAGCATGAACGC
RBdS075M08 pGCAP10 GGGTGGCGGACCCTTGGGGTCTGGACGCAACGGCGGCGGGAGCATGAACGCCCCTCCAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl