Prev. |  KEGG KO K03008 > 

RIKEN DNA Bank Human Resource - POLR2J

Gene ID NCBI Gene 5439 |  KEGG hsa:5439
Gene Symbol POLR2J
Protein Name RNA polymerase II subunit J
Synonyms POLR2J1|RPB11|RPB11A|RPB11m|hRPB14
Ortholog resources KEGG ortholog (KEGG orthology K03008) in the DNA Bank
Featured content Huntington disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX033933 IRAK084N21 pCMV-SPORT6 BC040116 NM_006234 Full
HGY093146 IRAL032O10 pDNR-LIB BC024165 NM_006234 Full
HGY100508 IRAL051E12 pDNR-LIB BC065711 NM_006234 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE028255 W01A070K15 pENTR-TOPO IRAL032O10 BC024165 NM_006234  
HGE028257 W01A070K17 pENTR-TOPO IRAL032O10 BC024165 NM_006234  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041204 ARe03A04 pKA1U5 NM_006234.4  
GCTCTTATTAGGGCTCTGGTGGCGGCGGCGGCGGACCCTTGGGGTCTGGACGCGACGGCG
HKR073779 ARe84H11 pKA1U5 NM_006234.4  
GGGACCCTTGGGGTCTGGACGCNACGGCGGCCGGTGAATGAACGCCCCATCCAGCCGTTC
HKR184955 ARi62G11 pGCAP10 NM_006234.4  
GATTAGGGCTCTGGTGGCGGCGGTGGCGGACACTTGGGGTCTGGACGCAACGGCGGCGGG
HKR188058 ARi70C10 pGCAP10 NM_006234.4  
GAGAGGCCTCTTATTAGGGCTCTGGTGGCGGCGGCGGCGGACCCTTGGGGTCTGGACGCG
HKR247486 ARiS118L22 pGCAP10 NM_006234.4  
GGACACTTGGGGTCTGGACGCAACGGCGGCGGGAGCATGAACGCCCCTCCAGCCTTCGAG
HKR342803 RBb57A03 pGCAP1 NM_006234.4  
GGGACCCTTGGGGTCTGGACGCGACGGCGGCGGGAGCATGAACGCCCCTCCAGCCTTCGA
HKR370860 RBd27C12 pGCAP10 NM_006234.4  
GATTAGGGCTCTGGTGGCGGCGGTGGCGGACACTTGGGGTCTGGACGCAACGGCGGCGGG
HKR386101 RBd65E05 pGCAP10 NM_006234.4  
GACTTGGGGTCTGGACGCAACGGCGGCGGGAGCATGAACGCCCCTCCAGCCTTCGAGTCG
HKR405211 RBdS013A11 pGCAP10 NM_006234.4  
GGGTGGCGGCGGCGGCGGACCCTTGGGGTCTGGACGCGACGGCGGCGGGAGCATGAACGC
HKR430296 RBdS075M08 pGCAP10 NM_006234.4  
GGGTGGCGGACCCTTGGGGTCTGGACGCAACGGCGGCGGGAGCATGAACGCCCCTCCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl