Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00718

HP ID(1) HP00718
Gene ID(2) 55651
Gene Symbol finder NHP2
Protein Name NHP2 ribonucleoprotein homolog (yeast)
RefSeq NM_017838.3
Length of RefSeq (bp) 867
Chromosome 5q35.3
Reference DDBJ accession
UniGene Hs.27222

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe22A08 pKA1U5 GGTGATGCCTAAAGCTGTGGACCGCGTGGGCTCGCCTCCCTGGGACTAGGTTTCAGCGGC
ARi03H09 pGCAP10 GGTGGACCGCGTGGGCTCGCCTCCCTGGGACTAGGTTTCAGCGGCCGCTGCGATGACCAA
ARi39E12 pGCAP10 TGGACCGCGTGGGCTCGCCTCCCTGGGACTAGGTTTCAGCGGCCGCTGCGATGACCAAAA
ARiS085G02 pGCAP10 GGGACCGCGTGGGCTCGCCTCCCTGGGACTAGGTTTCAGCGGCCGCTGCGATGACCAAAA
ARiS109K12 pGCAP10 GTGATGCCTAAAGCTGTGGACCGCGTGGGCTCGCCTCCCTGGGACTAGGTTTCAGCGGCC
RBb05F02 pKA1U5 GAAAGCTGTGGACCGCGTGGGCTCGCCTCCCTGGGACTAGGTTTCAGCGGCCGCTGCGAT
RBb09D03 pKA1U5 GTTTCAGCGGCCGCTGCGATGACCAAAATAAAGGCAGATCCCGACGGGCCCGAGGCTCAG
RBb49C03 pGCAP1 GGACCTGGAAGTGATGCCTAAAGCTGTGGACCGCGNTGGGCCCCTTTATNNCTGGGACTA
RBd25D06 pGCAP10 GGGGACTAGGTTTCAGCGGCCGCTGCGATGACCAAAATAAAGGCAGATCCCGACGGGCCC
RBd46H07 pGCAP10 GGTGATGCCTAAAGCTGTGGACCGCGTGGGCTCGCCTCCCTGGGACTAGGTTTCAGCGGC
RBd49F07 pGCAP10 GGGACCGCGTGGGCTCGCCTCCCTGGGACTAGGTTTCAGCGGCCGCTGCGATGACCAAAA
RBd62C05 pGCAP10 GGGACCGCGTGGGCTCGCCTCCCTGGGACTAGGTTTCAGCGGCCGCTGCGATGACCAAAA
RBdS051E08 pGCAP10 GGGACCGCGTGGGCTCGCCTCCCTGGGACTAGGTTTCAGCGGCCGCTGCGATGACCAAAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl