Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NHP2

Gene ID (NCBI) 55651
Gene Symbol NHP2
Protein Name NHP2 ribonucleoprotein
Synonyms DKCB2|NHP2P|NOLA2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K11129)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082827 IRAL007B03 pOTB7 BC000009 NM_017838 Full
HGY086889 IRAL017D17 pOTB7 BC006387 NM_017838 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR161377 ARi03H09 pGCAP10 NM_017838.3  
GGTGGACCGCGTGGGCTCGCCTCCCTGGGACTAGGTTTCAGCGGCCGCTGCGATGACCAA
HKR048808 ARe22A08 pKA1U5 NM_017838.3  
GGTGATGCCTAAAGCTGTGGACCGCGTGGGCTCGCCTCCCTGGGACTAGGTTTCAGCGGC
HKR175708 ARi39E12 pGCAP10 NM_017838.3  
TGGACCGCGTGGGCTCGCCTCCCTGGGACTAGGTTTCAGCGGCCGCTGCGATGACCAAAA
HKR234146 ARiS085G02 pGCAP10 NM_017838.3  
GGGACCGCGTGGGCTCGCCTCCCTGGGACTAGGTTTCAGCGGCCGCTGCGATGACCAAAA
HKR243852 ARiS109K12 pGCAP10 NM_017838.3  
GTGATGCCTAAAGCTGTGGACCGCGTGGGCTCGCCTCCCTGGGACTAGGTTTCAGCGGCC
HKR322122 RBb05F02 pKA1U5 NM_017838.3  
GAAAGCTGTGGACCGCGTGGGCTCGCCTCCCTGGGACTAGGTTTCAGCGGCCGCTGCGAT
HKR323675 RBb09D03 pKA1U5 NM_017838.3  
GTTTCAGCGGCCGCTGCGATGACCAAAATAAAGGCAGATCCCGACGGGCCCGAGGCTCAG
HKR370078 RBd25D06 pGCAP10 NM_017838.3  
GGGGACTAGGTTTCAGCGGCCGCTGCGATGACCAAAATAAAGGCAGATCCCGACGGGCCC
HKR339651 RBb49C03 pGCAP1 NM_017838.3  
GGACCTGGAAGTGATGCCTAAAGCTGTGGACCGCGNTGGGCCCCTTTATNNCTGGGACTA
HKR378575 RBd46H07 pGCAP10 NM_017838.3  
GGTGATGCCTAAAGCTGTGGACCGCGTGGGCTCGCCTCCCTGGGACTAGGTTTCAGCGGC
HKR379727 RBd49F07 pGCAP10 NM_017838.3  
GGGACCGCGTGGGCTCGCCTCCCTGGGACTAGGTTTCAGCGGCCGCTGCGATGACCAAAA
HKR384853 RBd62C05 pGCAP10 NM_017838.3  
GGGACCGCGTGGGCTCGCCTCCCTGGGACTAGGTTTCAGCGGCCGCTGCGATGACCAAAA
HKR420504 RBdS051E08 pGCAP10 NM_017838.3  
GGGACCGCGTGGGCTCGCCTCCCTGGGACTAGGTTTCAGCGGCCGCTGCGATGACCAAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.29

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl