Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00687

HP ID(1) HP00687
Gene ID(2) 4833
Gene Symbol finder NME4
Protein Name non-metastatic cells 4, protein expressed in
RefSeq NM_005009.2
Length of RefSeq (bp) 1059
Chromosome 16p13.3
Reference DDBJ accession
UniGene Hs.9235

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe36E02 pKA1U5 GACAGCGGCCCGCGGGCCGGGCGTCATGGGCGGCCTCTTCTGGCGCTCCGCGCTGCGGGG
ARf05A02 pKA1U5 TCCTCGCGCTCACAGCGGCCCGCGGGCCGGGCGTCATGGGCGGCCTCTTCTGGCGCTCCG
ARi56F12 pGCAP10 GCGGGCGTCATGGGCGGCCTCTTCTGGCGCTCCGCGCTGCGGGGGCTGCGCTGCGGCCCG
ARi56H06 pGCAP10 GACAGCGGCCCGCGGGCCGGGCGTCATGGGCGGCCTCTTCTGGCGCTCCGCGCTGCGGGG
ARiS150K09 pGCAP10 GGCTCCTCGCGCTCACAGCGGCCCGCGGGCCGGGCGTCATGGGCGGCCTCTTCTGGCGCT
RBd36A12 pGCAP10 GCTCTTCTGGCGCTCCGCGCTGCGGGGGCTGCGCTGCGGCCCGCGGGCCCCGGGCCCGAG
RBd62D03 pGCAP10 GGTCATGGGCGGCCTCTTCTGGCGCTCCGCGCTGCGGGGGCTGCGCTGCGGCCCGCGGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl