Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NME4

Gene ID (NCBI) 4833
Gene Symbol NME4
Protein Name NME/NM23 nucleoside diphosphate kinase 4
Synonyms NDPK-D|NM23H4|nm23-H4
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K00940)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY085675 IRAL014D03 pOTB7 BC004880 NM_005009 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR082002 ARf05A02 pKA1U5 NM_005009.2  
TCCTCGCGCTCACAGCGGCCCGCGGGCCGGGCGTCATGGGCGGCCTCTTCTGGCGCTCCG
HKR054498 ARe36E02 pKA1U5 NM_005009.2  
GACAGCGGCCCGCGGGCCGGGCGTCATGGGCGGCCTCTTCTGGCGCTCCGCGCTGCGGGG
HKR182532 ARi56F12 pGCAP10 NM_005009.2  
GCGGGCGTCATGGGCGGCCTCTTCTGGCGCTCCGCGCTGCGGGGGCTGCGCTGCGGCCCG
HKR182574 ARi56H06 pGCAP10 NM_005009.2  
GACAGCGGCCCGCGGGCCGGGCGTCATGGGCGGCCTCTTCTGGCGCTCCGCGCTGCGGGG
HKR260249 ARiS150K09 pGCAP10 NM_005009.2  
GGCTCCTCGCGCTCACAGCGGCCCGCGGGCCGGGCGTCATGGGCGGCCTCTTCTGGCGCT
HKR374412 RBd36A12 pGCAP10 NM_005009.2  
GCTCTTCTGGCGCTCCGCGCTGCGGGGGCTGCGCTGCGGCCCGCGGGCCCCGGGCCCGAG
HKR384875 RBd62D03 pGCAP10 NM_005009.2  
GGTCATGGGCGGCCTCTTCTGGCGCTCCGCGCTGCGGGGGCTGCGCTGCGGCCCGCGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl