Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00686

HP ID(1) HP00686
Gene ID(2) 7334
Gene Symbol finder UBE2N
Protein Name ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast)
RefSeq NM_003348.3
Length of RefSeq (bp) 2568
Chromosome 12q22
Reference DDBJ accession
UniGene Hs.524630

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe05E08 pKA1U5 GGAGACCAGCAGGCCGAACTCGGGTTCTGACAAGATGGCCGGGCTGCCCCGCAGGATCAT
ARe53C01 pKA1U5 GGGAGCCCGGGACTTCCACTCGTGCGTGAGGCGAGAGGAGCCGGAGACGAGACCAGAGGC
ARi08C05 pGCAP10 GAATTTGGAGTCCGCTTAAGGGAGGCGGCGGCAGCGCGGCGGTGGGGNTGNGGCCGAGGC
ARi08D05 pGCAP10 GGTGAGGCGAGAGGAGCCGGAGACGAGACCAGAGGCCGAACTCGGGTTCTGACAAGATGG
ARi56F11 pGCAP10 TGGTGCGTGAGGCGAGAGGAGCCGGAGACGAGACCAGAGGCCGAACTCGGGTTCTGACAA
ARiS109C09 pGCAP10 GAGAGGCCNNNCTCGGGTTCTGACAAGATGGCCGGGCTGCCCCGCAGGATCATCAAGGAA
RBb52G07 pGCAP1 GGAGAGGAGCCGGAGACGAGACCAGTAGGCCGAACTCGGGCTTCTGACAAGATGGCCGGG
RBd65D07 pGCAP10 GGGGTTCTGACAAGATGGCCGGGCTGCCCCGCAGGATCATCAAGGAAACCCAGCGTTTGC
RBd88B05 pGCAP10 GACCAGAGGCCGAACTCGGGTTCTGACAAGATGGCCGGGCTGCCCCGCAGGATCATCAAG
RBdS013D02 pGCAP10 GCCCCGGAAGTGGAGCCCGGGACTTCCACTCGTGCGTGAGGCGAGAGGAGCCGGAGACGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl