Prev. |  KEGG KO K10580 > 

RIKEN DNA Bank Human Resource - UBE2N

Gene ID NCBI Gene 7334 |  KEGG hsa:7334
Gene Symbol UBE2N
Protein Name ubiquitin conjugating enzyme E2 N
Synonyms HEL-S-71|UBC13|UBCHBEN; UBC13|UbcH-ben|UbcH13
Ortholog resources KEGG ortholog (KEGG orthology K10580) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001261 IRAK003C13 pCMV-SPORT6 BC003365 NM_003348 Full
HGY080568 IRAL001G24 pOTB7 BC000396 NM_003348 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042104 ARe05E08 pKA1U5 NM_003348.3  
GGAGACCAGCAGGCCGAACTCGGGTTCTGACAAGATGGCCGGGCTGCCCCGCAGGATCAT
HKR061249 ARe53C01 pKA1U5 NM_003348.3  
GGGAGCCCGGGACTTCCACTCGTGCGTGAGGCGAGAGGAGCCGGAGACGAGACCAGAGGC
HKR163253 ARi08C05 pGCAP10 NM_003348.3  
GAATTTGGAGTCCGCTTAAGGGAGGCGGCGGCAGCGCGGCGGTGGGGNTGNGGCCGAGGC
HKR163277 ARi08D05 pGCAP10 NM_003348.3  
GGTGAGGCGAGAGGAGCCGGAGACGAGACCAGAGGCCGAACTCGGGTTCTGACAAGATGG
HKR182531 ARi56F11 pGCAP10 NM_003348.3  
TGGTGCGTGAGGCGAGAGGAGCCGGAGACGAGACCAGAGGCCGAACTCGGGTTCTGACAA
HKR243657 ARiS109C09 pGCAP10 NM_003348.3  
GAGAGGCCNNNCTCGGGTTCTGACAAGATGGCCGGGCTGCCCCGCAGGATCATCAAGGAA
HKR340951 RBb52G07 pGCAP1 NM_003348.3  
GGAGAGGAGCCGGAGACGAGACCAGTAGGCCGAACTCGGGCTTCTGACAAGATGGCCGGG
HKR386079 RBd65D07 pGCAP10 NM_003348.3  
GGGGTTCTGACAAGATGGCCGGGCTGCCCCGCAGGATCATCAAGGAAACCCAGCGTTTGC
HKR395229 RBd88B05 pGCAP10 NM_003348.3  
GACCAGAGGCCGAACTCGGGTTCTGACAAGATGGCCGGGCTGCCCCGCAGGATCATCAAG
HKR405274 RBdS013D02 pGCAP10 NM_003348.3  
GCCCCGGAAGTGGAGCCCGGGACTTCCACTCGTGCGTGAGGCGAGAGGAGCCGGAGACGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl