Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00683

HP ID(1) HP00683
Gene ID(2) 4697
Gene Symbol finder NDUFA4
Protein Name NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa
RefSeq NM_002489.2
Length of RefSeq (bp) 823
Chromosome 7p21.3
Reference DDBJ accession
UniGene Hs.50098

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe28B01 pKA1U5 GGCAGATAATTTTTAGCTTAGGGCCTGGTGGCTAGGTCGGTTCTCTCCTTTCCAGTCGGA
ARe28B03 pKA1U5 GGTTTTGAATAAAGTATTCCCTGGTCTNGANGGNTANGATCAGANCTCATCCATTTCCAG
ARe41B04 pKA1U5 GGGAAGTCGTAGNGGTCTCATTGCAGATAATTTTTAGCTTAGGGCCTGGTGGCTAGGTCG
ARi23B05 pGCAP10 GGGTCCTGGGTGACTTTGGAAGTCCGTAGTGTCTCATTGCAGATAATTTTTAGCTTAGGG
ARi44H07 pGCAP10 GGAAGTCCGTAGTGTCTCATTGCAGATAATTTTTACCTTACGGCCTGGTGGCTAGGGCGG
ARi52A01 pGCAP10 CGGCCGGCCGATGCTTTCCAGTCGGAGACCTCTGCCGCAAACATGCTCCGCCAGATCATC
RBb29C04 pGCAP1 GCTGGGTGACTTTGGAAGTCCGTAGTGTCTCATTGCAGATAATTTTTAGCTTAGGGCCTG
RBb61A01 pGCAP1 GGGAAGTCCGTAGTGTCTCATTGCAGATAATTTTTAGCTTAGGGCCTGGTGGCTAGGTCG
RBd14E01 pGCAP10 GGGAAGTCCGTAGTGTCTCATTGCAGATAATTTTTAGCTTAGGGCCTGGTGGCTAGGTCG
RBd21A12 pGCAP10 GATTTTTTTAGCTTAGGGCCTGGTGGCTAGGTCGGTTCTCTCCTTTCCAGTCGGAGACCT
RBd55C07 pGCAP10 GCCTTTCCNGTCGGAGACCTCTGCCGCAAACATGCTCCGCCANNNNNNCGGTCAGGCCAA
RBdS014G06 pGCAP10 GAGGTAGGAGGTCCTGGGTGACTTTGGAAGTCCGTAGTGTCTCATTGCAGATAATTTTTA
RBdS156D17 pGCAP10 GAAGGGTCCTTCAGGTAGGAGGTCCTGGGTGACTTTGGAAGTCCGTAGTGTCTCATTGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl