Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NDUFA4

Gene ID (NCBI) 4697
Gene Symbol NDUFA4
Protein Name NDUFA4, mitochondrial complex associated
Synonyms CI-9k|CI-MLRQ|MLRQ
Databases KEGG hsa:4697 |  NCBI Gene 4697
Featured content Ortholog resources in the DNA Bank (KEGG orthology K03948)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR051225 ARe28B01 pKA1U5 NM_002489.2  
GGCAGATAATTTTTAGCTTAGGGCCTGGTGGCTAGGTCGGTTCTCTCCTTTCCAGTCGGA
HKR051227 ARe28B03 pKA1U5 NM_002489.2  
GGTTTTGAATAAAGTATTCCCTGGTCTNGANGGNTANGATCAGANCTCATCCATTTCCAG
HKR056428 ARe41B04 pKA1U5 NM_002489.2  
GGGAAGTCGTAGNGGTCTCATTGCAGATAATTTTTAGCTTAGGGCCTGGTGGCTAGGTCG
HKR169229 ARi23B05 pGCAP10 NM_002489.2  
GGGTCCTGGGTGACTTTGGAAGTCCGTAGTGTCTCATTGCAGATAATTTTTAGCTTAGGG
HKR177775 ARi44H07 pGCAP10 NM_002489.2  
GGAAGTCCGTAGTGTCTCATTGCAGATAATTTTTACCTTACGGCCTGGTGGCTAGGGCGG
HKR180801 ARi52A01 pGCAP10 NM_002489.2  
CGGCCGGCCGATGCTTTCCAGTCGGAGACCTCTGCCGCAAACATGCTCCGCCAGATCATC
HKR331652 RBb29C04 pGCAP1 NM_002489.2  
GCTGGGTGACTTTGGAAGTCCGTAGTGTCTCATTGCAGATAATTTTTAGCTTAGGGCCTG
HKR344401 RBb61A01 pGCAP1 NM_002489.2  
GGGAAGTCCGTAGTGTCTCATTGCAGATAATTTTTAGCTTAGGGCCTGGTGGCTAGGTCG
HKR365697 RBd14E01 pGCAP10 NM_002489.2  
GGGAAGTCCGTAGTGTCTCATTGCAGATAATTTTTAGCTTAGGGCCTGGTGGCTAGGTCG
HKR368412 RBd21A12 pGCAP10 NM_002489.2  
GATTTTTTTAGCTTAGGGCCTGGTGGCTAGGTCGGTTCTCTCCTTTCCAGTCGGAGACCT
HKR382055 RBd55C07 pGCAP10 NM_002489.2  
GCCTTTCCNGTCGGAGACCTCTGCCGCAAACATGCTCCGCCANNNNNNCGGTCAGGCCAA
HKR405750 RBdS014G06 pGCAP10 NM_002489.2  
GAGGTAGGAGGTCCTGGGTGACTTTGGAAGTCCGTAGTGTCTCATTGCAGATAATTTTTA
HKR462489 RBdS156D17 pGCAP10 NM_002489.2  
GAAGGGTCCTTCAGGTAGGAGGTCCTGGGTGACTTTGGAAGTCCGTAGTGTCTCATTGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl