Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00657

HP ID(1) HP00657
Gene ID(2) 10972
Gene Symbol finder TMED10
Protein Name transmembrane emp24-like trafficking protein 10 (yeast)
RefSeq NM_006827.5
Length of RefSeq (bp) 4163
Chromosome 14q24.3
Reference DDBJ accession
UniGene Hs.74137

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe03H04 pKA1U5 GGGTTCCGGCGCGGTTGAGGCCTTCGGTGGTGAACGAGATCTCCAGCACCATGNTCTGGT
ARiS088K08 pGCAP10 GCCCCCCGGTTCCGGCGCGGTTGAGGCCTTCGGTGGTGAACGAGTCTCCAGCACCATGTC
RBd83A12 pGCAP10 GGGTGGTGAACGAGTCTCCAGCACCATGTCTGGTTTGTCTGGCCCACCAGCCCGGCGCGG
RBdS177L16 pGCAP10 GGAACGAGTCTCCAGCACCATGTCTGGTTTGTCTGGCCCACCAGCCCGGCGCGGCCCTTT
RBdS187C23 pGCAP10

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl