Prev. |  KEGG KO K20352 > 

RIKEN DNA Bank Human Resource - TMED10

Gene ID NCBI Gene 10972 |  KEGG hsa:10972
Gene Symbol TMED10
Protein Name transmembrane p24 trafficking protein 10
Synonyms P24(DELTA)|S31I125|S31III125|TMP21|Tmp-21-I|p23|p24d1
Ortholog resource in our bank

  TMED10

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081004 IRAL002I12 pOTB7 BC001496 NM_006827 Full/var
HGY084195 IRAL010I03 pOTB7 BC001825 NM_006827 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097644 M01C044B20 pDONR221 MGC11-H10 BC001496 NM_006827  
HGE097692 M01C044D20 pDONR221 MGC11-H10 BC001496 NM_006827  
HGE097740 M01C044F20 pDONR221 MGC11-H10 BC001496 NM_006827  
HGE097788 M01C044H20 pDONR221 MGC11-H10 BC001496 NM_006827  
HGE097836 M01C044J20 pDONR221 MGC11-H10 BC001496 NM_006827  
HGE097884 M01C044L20 pDONR221 MGC11-H10 BC001496 NM_006827  
HGE097932 M01C044N20 pDONR221 MGC11-H10 BC001496 NM_006827  
HGE097980 M01C044P20 pDONR221 MGC11-H10 BC001496 NM_006827  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR041372 ARe03H04 pKA1U5 NM_006827.5  
GGGTTCCGGCGCGGTTGAGGCCTTCGGTGGTGAACGAGATCTCCAGCACCATGNTCTGGT
HKR235448 ARiS088K08 pGCAP10 NM_006827.5  
GCCCCCCGGTTCCGGCGCGGTTGAGGCCTTCGGTGGTGAACGAGTCTCCAGCACCATGTC
HKR393212 RBd83A12 pGCAP10 NM_006827.5  
GGGTGGTGAACGAGTCTCCAGCACCATGTCTGGTTTGTCTGGCCCACCAGCCCGGCGCGG
HKR471080 RBdS177L16 pGCAP10 NM_006827.5  
GGAACGAGTCTCCAGCACCATGTCTGGTTTGTCTGGCCCACCAGCCCGGCGCGGCCCTTT
HKR474871 RBdS187C23 pGCAP10 NM_006827.5  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl