Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00655

HP ID(1) HP00655
Gene ID(2) 27339
Gene Symbol finder PRPF19
Protein Name PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae)
RefSeq NM_014502.3
Length of RefSeq (bp) 2221
Chromosome 11q12.2
Reference DDBJ accession
UniGene Hs.502705

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb42A01 pGCAP1 GTNTTGGCNANTTNCNGCCTANGTGTTGCAAGGTGTGATGCGANGCGCGGNNTG
RBd08A11 pGCAP10 ???TTTCGTTAGGTGCTGAGGCTGTGGCGCGCGGCTGTCCCCATTCCCACGTGAAGCGCT
RBd35E04 pGCAP10 GAGGCTGTGGCGCGCGGCTGTCCCCATTCCCACGTGAAGCGCTACGCTAGCATCGCTCGG
RBdS013I17 pGCAP10 GGTTAGGTGCTGAAGGCTGTGGCGCGCGGCTGTCCCCATTCCCACGTGAAGCGCTACGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl