Prev. |  KEGG KO K10599 > 

RIKEN DNA Bank Human Resource - PRPF19

Gene ID NCBI Gene 27339 |  KEGG hsa:27339
Gene Symbol PRPF19
Protein Name pre-mRNA processing factor 19
Synonyms NMP200|PRP19|PSO4|SNEV|UBOX4|hPSO4
Ortholog resources KEGG ortholog (KEGG orthology K10599) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080733 IRAL001N21 pOTB7 BC008719 NM_014502 Full
HGY081076 IRAL002L12 pOTB7 BC018665 NM_014502 Full
HGY084321 IRAL010N09 pOTB7 BC018698 NM_014502

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR336801 RBb42A01 pGCAP1 NM_014502.3  
GTNTTGGCNANTTNCNGCCTANGTGTTGCAAGGTGTGATGCGANGCGCGGNNTG
HKR363211 RBd08A11 pGCAP10 NM_014502.3  
???TTTCGTTAGGTGCTGAGGCTGTGGCGCGCGGCTGTCCCCATTCCCACGTGAAGCGCT
HKR374100 RBd35E04 pGCAP10 NM_014502.3  
GAGGCTGTGGCGCGCGGCTGTCCCCATTCCCACGTGAAGCGCTACGCTAGCATCGCTCGG
HKR405409 RBdS013I17 pGCAP10 NM_014502.3  
GGTTAGGTGCTGAAGGCTGTGGCGCGCGGCTGTCCCCATTCCCACGTGAAGCGCTACGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl