Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00639

HP ID(1) HP00639
Gene ID(2) 5033
Gene Symbol finder P4HA1
Protein Name prolyl 4-hydroxylase, alpha polypeptide I
RefSeq NM_000917.3
Length of RefSeq (bp) 2860
Chromosome 10q21.3-q23.1
Reference DDBJ accession
UniGene Hs.500047

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe05B02 pKA1U5 GAGTCGCGCCGCCAGCGGGCTGAGGGTAGGAAGTAGCCGCTCCGAGTGGAGGCGACTGGG
ARe11C04 pKA1U5 GAGTCGCGCCGCCAGCGGGCTGAGGGTAGGAAGTAGCCGCTCCGAGTGGAGGCGACTGGG
ARe22A12 pKA1U5 TGAGTCGCCTCCTCCCTGGCGCTGCCATCGCGGCCTAGAGGTTATAAAAGGGCTAACGGG
ARe88H06 pKA1U5 GGCCCAGNTCGCGCCGCCAGCGGGCTGAGGGTAGGAAGTAGCCGCTCCGAGTGGAGGCGA
RBdS015O23 pGCAP10 GGCTCCGAGTGGAGGCGACTGGGGGCTGAAGAGCGCGCCGCCCTCTCGTCCCACTTTCCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl