Prev. |  KEGG KO K00472 > 

RIKEN DNA Bank Human Resource - P4HA1

Gene ID NCBI Gene 5033 |  KEGG hsa:5033
Gene Symbol P4HA1
Protein Name prolyl 4-hydroxylase subunit alpha 1
Synonyms P4HA
Ortholog resource in our bank

  P4HA1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018423 IRAK046A23 pBluescriptR BC034998 NM_001017962 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042026 ARe05B02 pKA1U5 NM_000917.3  
GAGTCGCGCCGCCAGCGGGCTGAGGGTAGGAAGTAGCCGCTCCGAGTGGAGGCGACTGGG
HKR044452 ARe11C04 pKA1U5 NM_000917.3  
GAGTCGCGCCGCCAGCGGGCTGAGGGTAGGAAGTAGCCGCTCCGAGTGGAGGCGACTGGG
HKR048812 ARe22A12 pKA1U5 NM_000917.3  
TGAGTCGCCTCCTCCCTGGCGCTGCCATCGCGGCCTAGAGGTTATAAAAGGGCTAACGGG
HKR075374 ARe88H06 pKA1U5 NM_000917.3  
GGCCCAGNTCGCGCCGCCAGCGGGCTGAGGGTAGGAAGTAGCCGCTCCGAGTGGAGGCGA
HKR406359 RBdS015O23 pGCAP10 NM_000917.3  
GGCTCCGAGTGGAGGCGACTGGGGGCTGAAGAGCGCGCCGCCCTCTCGTCCCACTTTCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl