Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00626

HP ID(1) HP00626
Gene ID(2) 5499
Gene Symbol finder PPP1CA
Protein Name protein phosphatase 1, catalytic subunit, alpha isoform
RefSeq NM_002708.3
Length of RefSeq (bp) 1488
Chromosome 11q13
Reference DDBJ accession
UniGene Hs.183994

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe05E06 pKA1U5 GGGGCTGGAGCGGCGGCGCCGCCATGTCCGACCCNTNNAAGCTCAACCTGGACTCGATCA
ARe06C05 pKA1U5 GAGCGGCGGCGCCGCCATGTCCGACAGCGAGAAGCTCAACCTGGACTCGATCATCGGGCG
ARe06C12 pKA1U5 GAGGCCGGAAGGAGGCTGCCGGAGGGCGGGAGGCAGGAGCGGGCCAGGAGCTGCTGGGCT
ARe75B11 pKA1U5 GGGGGCGGGCGGAAGGAGAGCCAGGCCGGAAGNAGNCTGCCGGAGGGCGGGAGGCAGGAG
ARe99E11 pKA1U5 GGCCGGAGGGCGGGAGGCAGGAGCGGGCCAGGAGCTGCTGGGCTGGAGCGGCGGCGCCGC
ARiS013F18 pGCAP10 GCGGAAGGAGGCTGCCGGAGGGCGGGAGGCAGGAGCGGGCCAGGAGCTGCTGGGCTGGAG
RBb12G05 pKA1U5 GGGGGGCGGACTGGGGCGGGCGGAAGGAGAGCCAGNNCGGAAGGAGGCTGCCGGAGGGCG
RBd67A11 pGCAP10 GAGGCCGGAAGGAGGCTGCCGGAGGGCGGGAGGCAGGAGCGGGCCAGGAGCTGCTGGGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl