DNA Bank Top |  KEGG KO K06269 > 

RIKEN DNA Bank Human Resource - PPP1CA

Gene ID NCBI Gene 5499 |  KEGG hsa:5499
Gene Symbol PPP1CA
Protein Name protein phosphatase 1 catalytic subunit alpha
Synonyms PP-1A|PP1A|PP1alpha|PPP1A
Featured content Hippo signaling (human)

Link

Ortholog resource in our bank

  PPP1CA


External database

human PPP1CA

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB14397 pCIneoFHF-PP1A Expression vector of FLAG- and His6-tagged human PP1A.    
RDB13971 pClneoLuc-PP1A Expression vector of luciferase-fused PP1A.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083240 IRAL008B16 pOTB7 BC001888 NM_002708 Full
HGY085861 IRAL014K21 pOTB7 BC004482 NM_002708 Full
HGY089360 IRAL023G16 pOTB7 BC008010 NM_002708 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE031770 W01A079H02 pENTR-TOPO IRAL008B16 BC001888 NM_002708  
HGE031776 W01A079H08 pENTR-TOPO IRAL008B16 BC001888 NM_002708  
HGE031780 W01A079H12 pENTR-TOPO IRAL008B16 BC001888 NM_002708  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042102 ARe05E06 pKA1U5 NM_002708.3  
GGGGCTGGAGCGGCGGCGCCGCCATGTCCGACCCNTNNAAGCTCAACCTGGACTCGATCA
HKR042453 ARe06C05 pKA1U5 NM_002708.3  
GAGCGGCGGCGCCGCCATGTCCGACAGCGAGAAGCTCAACCTGGACTCGATCATCGGGCG
HKR042460 ARe06C12 pKA1U5 NM_002708.3  
GAGGCCGGAAGGAGGCTGCCGGAGGGCGGGAGGCAGGAGCGGGCCAGGAGCTGCTGGGCT
HKR070035 ARe75B11 pKA1U5 NM_002708.3  
GGGGGCGGGCGGAAGGAGAGCCAGGCCGGAAGNAGNCTGCCGGAGGGCGGGAGGCAGGAG
HKR079707 ARe99E11 pKA1U5 NM_002708.3  
GGCCGGAGGGCGGGAGGCAGGAGCGGGCCAGGAGCTGCTGGGCTGGAGCGGCGGCGCCGC
HKR205338 ARiS013F18 pGCAP10 NM_002708.3  
GCGGAAGGAGGCTGCCGGAGGGCGGGAGGCAGGAGCGGGCCAGGAGCTGCTGGGCTGGAG
HKR324949 RBb12G05 pKA1U5 NM_002708.3  
GGGGGGCGGACTGGGGCGGGCGGAAGGAGAGCCAGNNCGGAAGGAGGCTGCCGGAGGGCG
HKR386811 RBd67A11 pGCAP10 NM_002708.3  
GAGGCCGGAAGGAGGCTGCCGGAGGGCGGGAGGCAGGAGCGGGCCAGGAGCTGCTGGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.10.04

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl