Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00603

HP ID(1) HP00603
Gene ID(2) 10577
Gene Symbol finder NPC2
Protein Name Niemann-Pick disease, type C2
RefSeq NM_006432.3
Length of RefSeq (bp) 921
Chromosome 14q24.3
Reference DDBJ accession
UniGene Hs.433222

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe22B12 pKA1U5 GCTTTCTTTCCCGAGCTTGGAACTTCGTTATCCGCGATGCGTTTCCTGGCAGCTACATTC
ARe48B05 pKA1U5 GCTTTCCCGAGCTTGGAACTTCGTTATCCGCGATGCGTTTCCTGGCAGCTACATTCCTGC
ARe49H11 pKA1U5 GGTTATCCGCGATGCGTTTCCTGGCAGCTACATTCCTGCTCCTGGCGCTCAGCACCGCTG
ARe65H04 pKA1U5 TTTTCTTTCCCGAGCTTGGAACTTCGTTATCCGCGATGCGTTTCCTGGCAGCTACATTCC
ARe70G04 pKA1U5 TGGCTGCTTCTTTCCCGAGCTTGGAACTTCGTTATCCGCGATGCGTTTCCTGGCAGCTAC
ARe80D09 pKA1U5 GGTTATCCGCGTATGCGTTTCCTGGCAGCTACATTCCTGCTCCTGGCGCTCAGACACCGC
ARe81H04 pKA1U5 GGTTATCCGCGATGCGTTTCCTGGCAGCTACATTCCTGCTCCTGGCGCTCAGCACCGCTG
ARi10B06 pGCAP10 CGGCCGGCCGATGCTTTCCCGAGCTTGGAACTTCGTTATCCGCGATGCGTTTCCTGGCAG
ARi19C11 pGCAP10 GCTTTCTTTCCCGAGCTTGGAACTTCGTTATCCGCGATGCGTTTCCTGGCAGCTACATTC
ARi34F07 pGCAP10 GGCTGCTTCTTTCCCGAGCTTGGAACTTCGTTATCCGCGATGCGTTTCCTGGCAGCTACA
ARi39D07 pGCAP10 GGCTGCTTCTTTCCCGAGCTTGGAACTTCGTTATCCGCGATGCGTTTCCTGGCAGCTACA
ARiS096F19 pGCAP10 TGTGTTCTTTCCCGAGCTTGGAACTTCGTTATCCGCGATGCGTTTCCTGGCAGCTACATT
RBb51B08 pGCAP1 GCCCGACAGGTTTGTCTTGTGACCGCGGGCGGCCGCTGCTTCTTTCCCGAGCTTGGAACT
RBb60G06 pGCAP1 TTGGCCCTTTCCCGAGCTTGGAACTTCGTTATCCGCGATGCGTTTCCTGGCAGCTACATT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl