Prev. |  KEGG KO K13443 > 

RIKEN DNA Bank Human Resource - NPC2

Gene ID NCBI Gene 10577 |  KEGG hsa:10577
Gene Symbol NPC2
Protein Name NPC intracellular cholesterol transporter 2
Synonyms EDDM1|HE1
Ortholog resources KEGG ortholog (KEGG orthology K13443) in the DNA Bank
Featured content Lysosome (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081864 IRAL004K24 pOTB7 BC002532 NM_006432 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE100035 M01C050B11 pDONR221 MGC14-G06 BC002532 NM_006432  
HGE100083 M01C050D11 pDONR221 MGC14-G06 BC002532 NM_006432  
HGE100131 M01C050F11 pDONR221 MGC14-G06 BC002532 NM_006432  
HGE100179 M01C050H11 pDONR221 MGC14-G06 BC002532 NM_006432  
HGE100227 M01C050J11 pDONR221 MGC14-G06 BC002532 NM_006432  
HGE100275 M01C050L11 pDONR221 MGC14-G06 BC002532 NM_006432  
HGE100323 M01C050N11 pDONR221 MGC14-G06 BC002532 NM_006432  
HGE100371 M01C050P11 pDONR221 MGC14-G06 BC002532 NM_006432  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048836 ARe22B12 pKA1U5 NM_006432.3  
GCTTTCTTTCCCGAGCTTGGAACTTCGTTATCCGCGATGCGTTTCCTGGCAGCTACATTC
HKR059229 ARe48B05 pKA1U5 NM_006432.3  
GCTTTCCCGAGCTTGGAACTTCGTTATCCGCGATGCGTTTCCTGGCAGCTACATTCCTGC
HKR059779 ARe49H11 pKA1U5 NM_006432.3  
GGTTATCCGCGATGCGTTTCCTGGCAGCTACATTCCTGCTCCTGGCGCTCAGCACCGCTG
HKR066172 ARe65H04 pKA1U5 NM_006432.3  
TTTTCTTTCCCGAGCTTGGAACTTCGTTATCCGCGATGCGTTTCCTGGCAGCTACATTCC
HKR068148 ARe70G04 pKA1U5 NM_006432.3  
TGGCTGCTTCTTTCCCGAGCTTGGAACTTCGTTATCCGCGATGCGTTTCCTGGCAGCTAC
HKR072081 ARe80D09 pKA1U5 NM_006432.3  
GGTTATCCGCGTATGCGTTTCCTGGCAGCTACATTCCTGCTCCTGGCGCTCAGACACCGC
HKR072572 ARe81H04 pKA1U5 NM_006432.3  
GGTTATCCGCGATGCGTTTCCTGGCAGCTACATTCCTGCTCCTGGCGCTCAGCACCGCTG
HKR164030 ARi10B06 pGCAP10 NM_006432.3  
CGGCCGGCCGATGCTTTCCCGAGCTTGGAACTTCGTTATCCGCGATGCGTTTCCTGGCAG
HKR167659 ARi19C11 pGCAP10 NM_006432.3  
GCTTTCTTTCCCGAGCTTGGAACTTCGTTATCCGCGATGCGTTTCCTGGCAGCTACATTC
HKR173727 ARi34F07 pGCAP10 NM_006432.3  
GGCTGCTTCTTTCCCGAGCTTGGAACTTCGTTATCCGCGATGCGTTTCCTGGCAGCTACA
HKR175679 ARi39D07 pGCAP10 NM_006432.3  
GGCTGCTTCTTTCCCGAGCTTGGAACTTCGTTATCCGCGATGCGTTTCCTGGCAGCTACA
HKR238539 ARiS096F19 pGCAP10 NM_006432.3  
TGTGTTCTTTCCCGAGCTTGGAACTTCGTTATCCGCGATGCGTTTCCTGGCAGCTACATT
HKR340432 RBb51B08 pGCAP1 NM_006432.3  
GCCCGACAGGTTTGTCTTGTGACCGCGGGCGGCCGCTGCTTCTTTCCCGAGCTTGGAACT
HKR344150 RBb60G06 pGCAP1 NM_006432.3  
TTGGCCCTTTCCCGAGCTTGGAACTTCGTTATCCGCGATGCGTTTCCTGGCAGCTACATT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.24

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl