Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00588

HP ID(1) HP00588
Gene ID(2) 7077
Gene Symbol finder TIMP2
Protein Name TIMP metallopeptidase inhibitor 2
RefSeq NM_003255.4
Length of RefSeq (bp) 3670
Chromosome 17q25
Reference DDBJ accession
UniGene Hs.633514

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe53C02 pKA1U5 GAGCAAACACATCCGNTAGAAGGCAGCGCGGCCGCCGAGAGCCGCAGCGCCGCTCGCCCG
ARi03C05 pGCAP10 GAAACACATCCGTAGAAGGCAGCGCGGCCGCCGAGAGCCGCAGCGCCGCTCGCCCGCCGC
ARi04G10 pGCAP10 GAGCAAACACATCCGTAGAAGGCAGCGCGGCCGCCGAGAGCCGCAGCGCCGCTCGCCCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl