Prev. |  KEGG KO K22583 > 

RIKEN DNA Bank Human Resource - TIMP2

Gene ID NCBI Gene 7077 |  KEGG hsa:7077
Gene Symbol TIMP2
Protein Name TIMP metallopeptidase inhibitor 2
Synonyms CSC-21K|DDC8
Ortholog resource in our bank

  TIMP2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067442 IRAK168K02 pBluescriptR BC071586 NM_003255 Full
HGX033951 IRAK084O15 pCMV-SPORT6 BC039613 NM_003255
HGX033979 IRAK084P19 pCMV-SPORT6 BC040445 NM_003255
HGX035943 IRAK089O07 pCMV-SPORT6 BC040039 NM_003255
HGY098974 IRAL047H06 pOTB7 BC052605 NM_003255 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE086047 M01C015B23 pDONR221 FLJ05-C12 BC052605 NM_003255  
HGE086095 M01C015D23 pDONR221 FLJ05-C12 BC052605 NM_003255  
HGE086143 M01C015F23 pDONR221 FLJ05-C12 BC052605 NM_003255  
HGE086191 M01C015H23 pDONR221 FLJ05-C12 BC052605 NM_003255  
HGE086239 M01C015J23 pDONR221 FLJ05-C12 BC052605 NM_003255  
HGE086287 M01C015L23 pDONR221 FLJ05-C12 BC052605 NM_003255  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR061250 ARe53C02 pKA1U5 NM_003255.4  
GAGCAAACACATCCGNTAGAAGGCAGCGCGGCCGCCGAGAGCCGCAGCGCCGCTCGCCCG
HKR161253 ARi03C05 pGCAP10 NM_003255.4  
GAAACACATCCGTAGAAGGCAGCGCGGCCGCCGAGAGCCGCAGCGCCGCTCGCCCGCCGC
HKR161754 ARi04G10 pGCAP10 NM_003255.4  
GAGCAAACACATCCGTAGAAGGCAGCGCGGCCGCCGAGAGCCGCAGCGCCGCTCGCCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl