Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00562

HP ID(1) HP00562
Gene ID(2) 5510
Gene Symbol finder PPP1R7
Protein Name protein phosphatase 1, regulatory subunit 7
RefSeq NM_002712.1
Length of RefSeq (bp) 1299
Chromosome 2q37.3
Reference DDBJ accession
UniGene Hs.36587

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS109K08 pGCAP10 GAGATTCCGGAAAGGGGAAGAGCAGCCAACATGGCGGCGGAACGCGGCGCGGGGCAGCAA
RBb48H07 pGCAP1 GGCAGCCAACATGGCGGCGGAACGCGGCGCGNGGCAGCAACAGTTCGCAGGAGATGATGG
RBb70B02 pGCAP1 TAAGAGCAGCCAACATGGCGGCGGAACGCGGCGCGGGGCAGCAACAGTCGCAGGAGATGA
RBd92H07 pGCAP10 GGAAGAGCAGCCAACATGGCGGCGGAACGCGGCGCGGGGCAGCAACAGTCGCAGGAGATG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl