Prev. |  KEGG KO K17550 > 

RIKEN DNA Bank Human Resource - PPP1R7

Gene ID NCBI Gene 5510 |  KEGG hsa:5510
Gene Symbol PPP1R7
Protein Name protein phosphatase 1 regulatory subunit 7
Synonyms SDS22
Ortholog resources KEGG ortholog (KEGG orthology K17550) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001567 IRAK003P07 pCMV-SPORT6 BC000910 NM_002712 Full
HGX008495 IRAK021D23 pCMV-SPORT6 BC012397 NM_002712 Partial
HGY084459 IRAL011C11 pOTB7 BC013001 NM_002712 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR243848 ARiS109K08 pGCAP10 NM_002712.1  
GAGATTCCGGAAAGGGGAAGAGCAGCCAACATGGCGGCGGAACGCGGCGCGGGGCAGCAA
HKR339375 RBb48H07 pGCAP1 NM_002712.1  
GGCAGCCAACATGGCGGCGGAACGCGGCGCGNGGCAGCAACAGTTCGCAGGAGATGATGG
HKR348026 RBb70B02 pGCAP1 NM_002712.1  
TAAGAGCAGCCAACATGGCGGCGGAACGCGGCGCGGGGCAGCAACAGTCGCAGGAGATGA
HKR396975 RBd92H07 pGCAP10 NM_002712.1  
GGAAGAGCAGCCAACATGGCGGCGGAACGCGGCGCGGGGCAGCAACAGTCGCAGGAGATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl