Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00542

HP ID(1) HP00542
Gene ID(2) 5052
Gene Symbol finder PRDX1
Protein Name peroxiredoxin 1
RefSeq NM_002574.2
Length of RefSeq (bp) 1262
Chromosome 1p34.1
Reference DDBJ accession
UniGene Hs.180909

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe23A02 pKA1U5 GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
ARe26B02 pKA1U5 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
ARe29B07 pKA1U5 TTGGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACT
ARe44B08 pKA1U5 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
ARe66C05 pKA1U5 GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
ARe66C09 pKA1U5 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
ARe70B02 pKA1U5 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
ARe83B11 pKA1U5 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
ARe84F10 pKA1U5 GCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGCTTTCTGCGACTTGTGTTGGGACTGCTG
ARe87G01 pKA1U5 GCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGCTTTCTGCGACTTGTGTTGGGACTGCTG
ARi43F05 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
ARi43G01 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
ARi49B02 pGCAP10 GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
ARi67A05 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACGTGTGTTGGGACTGCTG
ARiS013E05 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
ARiS109C24 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
ARiS150L07 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
ARiS161F08 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCNGTGGTTAGTTTCNGCNACTTGTGTTGGGACTGCTG
ARiS161L08 pGCAP10 GGCNNCNTGTTCTTGCCTGGNGTCNNTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBb06G07 pKA1U5 TGGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCT
RBb09F12 pKA1U5 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBb10C05 pKA1U5 GCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTGA
RBb11B01 pKA1U5 GGCNCCTCGGTCCTCGCNTNNCNCTCTNAGTGANAGGTTTCATGNGACTCCANACNGGAA
RBb11G01 pKA1U5 TGGGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
RBb14A03 pKA1U5 GGCGCGATCTTGNTTCTTGCCTGGATGATCGGCTGGATTAGNTTTCTGCGACTTGTTGTT
RBb15D08 pKA1U5 TTGGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
RBb26G09 pGCAP1 ATGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTG
RBb40D07 pGCAP1 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGGTG
RBb51D04 pGCAP1 GCGCGCTCTTGTTCTTGCCTGGATGTCGGTGGTTAGTTTCTGCGACTTGCTGTTGGGACT
RBb51E10 pGCAP1 GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
RBb57G09 pGCAP1 GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
RBb66A09 pGCAP1 GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
RBb71D09 pGCAP1 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBb72F07 pGCAP1 TGGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCT
RBd01H09 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBd10F07 pGCAP10 TGGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCT
RBd13E10 pGCAP10 GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
RBd13H08 pGCAP10 TGGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCT
RBd20D06 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBd28C11 pGCAP10 TTTTGGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACT
RBd29A08 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBd29B08 pGCAP10 GGCCTCTNGTTCTTGCCTGCCGANGATGGNTAGTTTCCCGAGTATGTGTTGGGACTGCTG
RBd29H11 pGCAP10 TGGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTGA
RBd30A11 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBd30D06 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBd33G10 pGCAP10 CGGCCGGCCGATGGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTG
RBd35G09 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBd38B09 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBd40H02 pGCAP10 GGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTGAT
RBd40H06 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBd45E10 pGCAP10 GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
RBd46F06 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBd47B08 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBd52A02 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBd52C12 pGCAP10 GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
RBd53B07 pGCAP10 GGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTGAT
RBd53E09 pGCAP10 GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
RBd55D11 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCNNNTTNTGTTGGGACTGCTG
RBd58G03 pGCAP10 TGGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTNCGANTTGTGTTGGGACTGCT
RBd62D07 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBd62F07 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBd63E02 pGCAP10 GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
RBd66D09 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBd69E08 pGCAP10 TGGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTG
RBd71A06 pGCAP10 GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
RBd74G12 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBd74H10 pGCAP10 GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
RBd76B07 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBd76D07 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBd91B10 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBd96F12 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBdS007E13 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBdS007F23 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBdS007I07 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBdS007M20 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBdS013B20 pGCAP10 TGGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCT
RBdS013C08 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBdS013I10 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBdS014K02 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBdS022D14 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBdS040N20 pGCAP10 GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
RBdS051P12 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBdS070B12 pGCAP10 GACTCTCGCGAGATCCCTACTGGCTATAAAGGCAGCGCCCCGGAGAGCTCTTGCGCGTCT
RBdS070N12 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGGTG
RBdS075P10 pGCAP10 TGGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCT
RBdS083N14 pGCAP10 TGGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCT
RBdS105D12 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBdS105L17 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBdS105M15 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBdS132G16 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBdS154A03 pGCAP10 TGGGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
RBdS154C21 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGCTGATAGGAAGATGTCTTCAGGAAATGCTAAA
RBdS154L01 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBdS154M04 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBdS177H13 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBdS187C04 pGCAP10 GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
RBdS177J18 pGCAP10 GGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTGAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl