Prev. |  KEGG KO K13279 > 

RIKEN DNA Bank Human Resource - PRDX1

Gene ID NCBI Gene 5052 |  KEGG hsa:5052
Gene Symbol PRDX1
Protein Name peroxiredoxin 1
Synonyms MSP23|NKEF-A|NKEFA|PAG|PAGA|PAGB|PRX1|PRXI|TDPX2
Ortholog resources KEGG ortholog (KEGG orthology K13279) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086468 IRAL016C20 pDNR-LIB BC007063 NM_181697 Full
HGY092420 IRAL031A20 pDNR-LIB BC021683 NM_181697 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049202 ARe23A02 pKA1U5 NM_002574.2  
GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
HKR050426 ARe26B02 pKA1U5 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR051631 ARe29B07 pKA1U5 NM_002574.2  
TTGGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACT
HKR057632 ARe44B08 pKA1U5 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR066453 ARe66C05 pKA1U5 NM_002574.2  
GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
HKR066457 ARe66C09 pKA1U5 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR068026 ARe70B02 pKA1U5 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR073235 ARe83B11 pKA1U5 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR073730 ARe84F10 pKA1U5 NM_002574.2  
GCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGCTTTCTGCGACTTGTGTTGGGACTGCTG
HKR074945 ARe87G01 pKA1U5 NM_002574.2  
GCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGCTTTCTGCGACTTGTGTTGGGACTGCTG
HKR177325 ARi43F05 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR177345 ARi43G01 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR179626 ARi49B02 pGCAP10 NM_002574.2  
GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
HKR186805 ARi67A05 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACGTGTGTTGGGACTGCTG
HKR205301 ARiS013E05 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR243672 ARiS109C24 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR260271 ARiS150L07 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR264528 ARiS161F08 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCNGTGGTTAGTTTCNGCNACTTGTGTTGGGACTGCTG
HKR264672 ARiS161L08 pGCAP10 NM_002574.2  
GGCNNCNTGTTCTTGCCTGGNGTCNNTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR322551 RBb06G07 pKA1U5 NM_002574.2  
TGGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCT
HKR323732 RBb09F12 pKA1U5 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR324053 RBb10C05 pKA1U5 NM_002574.2  
GCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTGA
HKR324425 RBb11B01 pKA1U5 NM_002574.2  
GGCNCCTCGGTCCTCGCNTNNCNCTCTNAGTGANAGGTTTCATGNGACTCCANACNGGAA
HKR324545 RBb11G01 pKA1U5 NM_002574.2  
TGGGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
HKR325603 RBb14A03 pKA1U5 NM_002574.2  
GGCGCGATCTTGNTTCTTGCCTGGATGATCGGCTGGATTAGNTTTCTGCGACTTGTTGTT
HKR326080 RBb15D08 pKA1U5 NM_002574.2  
TTGGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
HKR330553 RBb26G09 pGCAP1 NM_002574.2  
ATGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTG
HKR336079 RBb40D07 pGCAP1 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGGTG
HKR340476 RBb51D04 pGCAP1 NM_002574.2  
GCGCGCTCTTGTTCTTGCCTGGATGTCGGTGGTTAGTTTCTGCGACTTGCTGTTGGGACT
HKR340506 RBb51E10 pGCAP1 NM_002574.2  
GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
HKR342953 RBb57G09 pGCAP1 NM_002574.2  
GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
HKR348481 RBb71D09 pGCAP1 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR348927 RBb72F07 pGCAP1 NM_002574.2  
TGGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCT
HKR360577 RBd01H09 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR364127 RBd10F07 pGCAP10 NM_002574.2  
TGGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCT
HKR365306 RBd13E10 pGCAP10 NM_002574.2  
GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
HKR365376 RBd13H08 pGCAP10 NM_002574.2  
TGGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCT
HKR368078 RBd20D06 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR371259 RBd28C11 pGCAP10 NM_002574.2  
TTTTGGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACT
HKR371608 RBd29A08 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR371632 RBd29B08 pGCAP10 NM_002574.2  
GGCCTCTNGTTCTTGCCTGCCGANGATGGNTAGTTTCCCGAGTATGTGTTGGGACTGCTG
HKR371779 RBd29H11 pGCAP10 NM_002574.2  
TGGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTGA
HKR372011 RBd30A11 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR372078 RBd30D06 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR373354 RBd33G10 pGCAP10 NM_002574.2  
CGGCCGGCCGATGGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTG
HKR374153 RBd35G09 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR375233 RBd38B09 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR376170 RBd40H02 pGCAP10 NM_002574.2  
GGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTGAT
HKR376174 RBd40H06 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR378106 RBd45E10 pGCAP10 NM_002574.2  
GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
HKR378526 RBd46F06 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR378832 RBd47B08 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR380802 RBd52A02 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR380860 RBd52C12 pGCAP10 NM_002574.2  
GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
HKR381231 RBd53B07 pGCAP10 NM_002574.2  
GGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTGAT
HKR381305 RBd53E09 pGCAP10 NM_002574.2  
GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
HKR382083 RBd55D11 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCNNNTTNTGTTGGGACTGCTG
HKR383347 RBd58G03 pGCAP10 NM_002574.2  
TGGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTNCGANTTGTGTTGGGACTGCT
HKR384879 RBd62D07 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR384927 RBd62F07 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR385298 RBd63E02 pGCAP10 NM_002574.2  
GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
HKR386481 RBd66D09 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR387704 RBd69E08 pGCAP10 NM_002574.2  
TGGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTG
HKR388406 RBd71A06 pGCAP10 NM_002574.2  
GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
HKR389756 RBd74G12 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR389778 RBd74H10 pGCAP10 NM_002574.2  
GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
HKR390431 RBd76B07 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR390479 RBd76D07 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR396434 RBd91B10 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR398532 RBd96F12 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR402909 RBdS007E13 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR402943 RBdS007F23 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR402999 RBdS007I07 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR403108 RBdS007M20 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR405244 RBdS013B20 pGCAP10 NM_002574.2  
TGGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCT
HKR405256 RBdS013C08 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR405402 RBdS013I10 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR405842 RBdS014K02 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR408886 RBdS022D14 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR416332 RBdS040N20 pGCAP10 NM_002574.2  
GGCGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
HKR420772 RBdS051P12 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR428036 RBdS070B12 pGCAP10 NM_002574.2  
GACTCTCGCGAGATCCCTACTGGCTATAAAGGCAGCGCCCCGGAGAGCTCTTGCGCGTCT
HKR428324 RBdS070N12 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGGTG
HKR430370 RBdS075P10 pGCAP10 NM_002574.2  
TGGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCT
HKR433526 RBdS083N14 pGCAP10 NM_002574.2  
TGGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCT
HKR442084 RBdS105D12 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR442281 RBdS105L17 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR442303 RBdS105M15 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR452960 RBdS132G16 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR461603 RBdS154A03 pGCAP10 NM_002574.2  
TGGGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGC
HKR461669 RBdS154C21 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGCTGATAGGAAGATGTCTTCAGGAAATGCTAAA
HKR461865 RBdS154L01 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR461892 RBdS154M04 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR470981 RBdS177H13 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG
HKR471034 RBdS177J18 pGCAP10 NM_002574.2  
GGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTGAT
HKR474852 RBdS187C04 pGCAP10 NM_002574.2  
GGCGTCTTGTTCTTGCCTGGTGTCGGTGGTTAGTTTCTGCGACTTGTGTTGGGACTGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl