Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00527

HP ID(1) HP00527
Gene ID(2) 5537
Gene Symbol finder PPP6C
Protein Name protein phosphatase 6, catalytic subunit
RefSeq NM_002721.4
Length of RefSeq (bp) 4256
Chromosome 9q33.3
Reference DDBJ accession
UniGene Hs.715605

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS023P14 pGCAP10 GTCGGCCTCCGCCGCTGCCGCCGCCGCTGCTACAGCCGCCGCCGCCGCTGTTGCCGCGGC
RBdS007P11 pGCAP10 GGGCGTACCGACGTAGCGGGGAGAAACGGGTCGCGCTTTAACGGCGCTGCGCAGGCGCCA
RBdS014L05 pGCAP10 GGGCTTCNGCCTCCNCCGCTGCCGCCGCCGCTGCTACGGCCGCCGCCGCCGCTGTTGCCN

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl