Prev. |  KEGG KO K15498 > 

RIKEN DNA Bank Human Resource - PPP6C

Gene ID NCBI Gene 5537 |  KEGG hsa:5537
Gene Symbol PPP6C
Protein Name protein phosphatase 6 catalytic subunit
Synonyms PP6|PP6C
Ortholog resources KEGG ortholog (KEGG orthology K15498) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086553 IRAL016G09 pDNR-LIB BC006990 NM_002721

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE005653 W01A014C05 pENTR-TOPO IRAL016G09 BC006990 NM_002721  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR209574 ARiS023P14 pGCAP10 NM_002721.4  
GTCGGCCTCCGCCGCTGCCGCCGCCGCTGCTACAGCCGCCGCCGCCGCTGTTGCCGCGGC
HKR403171 RBdS007P11 pGCAP10 NM_002721.4  
GGGCGTACCGACGTAGCGGGGAGAAACGGGTCGCGCTTTAACGGCGCTGCGCAGGCGCCA
HKR405869 RBdS014L05 pGCAP10 NM_002721.4  
GGGCTTCNGCCTCCNCCGCTGCCGCCGCCGCTGCTACGGCCGCCGCCGCCGCTGTTGCCN

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl