Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00526

HP ID(1) HP00526
Gene ID(2) 5479
Gene Symbol finder PPIB
Protein Name peptidylprolyl isomerase B (cyclophilin B)
RefSeq NM_000942.4
Length of RefSeq (bp) 1045
Chromosome 15q21-q22
Reference DDBJ accession
UniGene Hs.434937

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe03H01 pKA1U5 GCTCAGCTGTCCGGGCTGCTTTCGCCTCCGCCTGCTGGATGCTGCGCCTCTCCGAACGCA
ARe48B06 pKA1U5 ATCCTGTGTAGCTTGTCCGGNCGTGCGTTTCTCCTCCGCCGTGATGGCATGCCTGCNCCG
ARe49B04 pKA1U5 AGCTGTCCGGGCTGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACATG
ARe63C03 pKA1U5 GGCTGCGCCTCTCCGAACGCAACATGTAAGGTGCTCCTTGCCGCCGCCCTCATCGCGGGG
ARe64D07 pKA1U5 GGCTANCGCCTCNTCTTGTTGTGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCC
ARi02B05 pGCAP10 GAGCTGTCCGGGCTGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACAT
ARi07E09 pGCAP10 GGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTT
ARi11G07 pGCAP10 GAGCTGTCCGGGCTGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACAT
ARi40B11 pGCAP10 GAGCTGTCCGGGCTGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACAT
ARi58A07 pGCAP10 GGGGGACCTACTATCCGGCGCCGAGCCGGAGGGGGGAAACGGCGCCCGCCGCCCGCCCGG
ARi70B06 pGCAP10 GGGCCTGTGGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTTGCCGCCGCCCT
ARiS008H10 pGCAP10 GGCCTGTGGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTTGCCGCCGCCCTC
ARiS008P18 pGCAP10 GGTGGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTTGCCGCCGCCCTCATCG
ARiS013M23 pGCAP10 GATGCTGCNCCTCNCCNNNCGCAACATGAAGGTGCTCCTTGCCGCCGCCCTCATCGCGGG
ARiS055E14 pGCAP10 GGCCTGTGGNNNCTGCTCCTCTCCTAACCCNGCNNNANAGTGCTCCTTGCCCCCGCCCTC
RBb07E10 pKA1U5 GCTGTGGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTTGCCGCCGCCCTCAT
RBb10D09 pKA1U5 GAGCTGTCCGGGCTGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACAT
RBb44F09 pGCAP1 TGTCAGCTGTCCGGGCTGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAA
RBb52D07 pGCAP1 GCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTTGCCGCCGCCC
RBb61A07 pGCAP1 GGCCTGTGGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTTGCCGCCGCCCTC
RBb63A02 pGCAP1
RBb72G07 pGCAP1 AGCTGTCCGGGCTGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACATG
RBd64F04 pGCAP10 GGTCCGGGCTGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACATGAAG
RBd88A08 pGCAP10 GGCCTGTGGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTTGCCGCCGCCCTC
RBd88H10 pGCAP10 GGTTTTTGCATCCTGCGCCCCCCCAAACCCCACGTGACGGTGCTCCTTCCCCCCACCCTC
RBd89F05 pGCAP10 GAGCTGTCCGGGCTGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACAT
RBdS007N07 pGCAP10 GGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTT
RBdS075D06 pGCAP10 GCTGTGGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTTGCCGCCGCCCTCAT
RBdS187H16 pGCAP10 GAGCTGTCCGGGCTGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl