Prev. |  KEGG KO K03768 > 

RIKEN DNA Bank Human Resource - PPIB

Gene ID NCBI Gene 5479 |  KEGG hsa:5479
Gene Symbol PPIB
Protein Name peptidylprolyl isomerase B
Synonyms CYP-S1|CYPB|HEL-S-39|OI9|SCYLP
Ortholog resources KEGG ortholog (KEGG orthology K03768) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081501 IRAL003M13 pOTB7 BC001125 NM_000942 Full
HGY088008 IRAL020A08 pOTB7 BC008848 NM_000942 Full
HGY094091 IRAL035D19 pDNR-LIB BC020800 NM_000942 Full
HGY095825 IRAL039J09 pOTB7 BC032138 NM_000942 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041369 ARe03H01 pKA1U5 NM_000942.4  
GCTCAGCTGTCCGGGCTGCTTTCGCCTCCGCCTGCTGGATGCTGCGCCTCTCCGAACGCA
HKR059230 ARe48B06 pKA1U5 NM_000942.4  
ATCCTGTGTAGCTTGTCCGGNCGTGCGTTTCTCCTCCGCCGTGATGGCATGCCTGCNCCG
HKR059628 ARe49B04 pKA1U5 NM_000942.4  
AGCTGTCCGGGCTGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACATG
HKR065251 ARe63C03 pKA1U5 NM_000942.4  
GGCTGCGCCTCTCCGAACGCAACATGTAAGGTGCTCCTTGCCGCCGCCCTCATCGCGGGG
HKR065679 ARe64D07 pKA1U5 NM_000942.4  
GGCTANCGCCTCNTCTTGTTGTGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCC
HKR160829 ARi02B05 pGCAP10 NM_000942.4  
GAGCTGTCCGGGCTGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACAT
HKR162905 ARi07E09 pGCAP10 NM_000942.4  
GGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTT
HKR164551 ARi11G07 pGCAP10 NM_000942.4  
GAGCTGTCCGGGCTGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACAT
HKR176035 ARi40B11 pGCAP10 NM_000942.4  
GAGCTGTCCGGGCTGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACAT
HKR183207 ARi58A07 pGCAP10 NM_000942.4  
GGGGGACCTACTATCCGGCGCCGAGCCGGAGGGGGGAAACGGCGCCCGCCGCCCGCCCGG
HKR188030 ARi70B06 pGCAP10 NM_000942.4  
GGGCCTGTGGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTTGCCGCCGCCCT
HKR203378 ARiS008H10 pGCAP10 NM_000942.4  
GGCCTGTGGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTTGCCGCCGCCCTC
HKR203578 ARiS008P18 pGCAP10 NM_000942.4  
GGTGGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTTGCCGCCGCCCTCATCG
HKR205511 ARiS013M23 pGCAP10 NM_000942.4  
GATGCTGCNCCTCNCCNNNCGCAACATGAAGGTGCTCCTTGCCGCCGCCCTCATCGCGGG
HKR222110 ARiS055E14 pGCAP10 NM_000942.4  
GGCCTGTGGNNNCTGCTCCTCTCCTAACCCNGCNNNANAGTGCTCCTTGCCCCCGCCCTC
HKR322906 RBb07E10 pKA1U5 NM_000942.4  
GCTGTGGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTTGCCGCCGCCCTCAT
HKR324081 RBb10D09 pKA1U5 NM_000942.4  
GAGCTGTCCGGGCTGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACAT
HKR337729 RBb44F09 pGCAP1 NM_000942.4  
TGTCAGCTGTCCGGGCTGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAA
HKR340879 RBb52D07 pGCAP1 NM_000942.4  
GCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTTGCCGCCGCCC
HKR344407 RBb61A07 pGCAP1 NM_000942.4  
GGCCTGTGGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTTGCCGCCGCCCTC
HKR345202 RBb63A02 pGCAP1 NM_000942.4  
HKR348951 RBb72G07 pGCAP1 NM_000942.4  
AGCTGTCCGGGCTGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACATG
HKR385724 RBd64F04 pGCAP10 NM_000942.4  
GGTCCGGGCTGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACATGAAG
HKR395208 RBd88A08 pGCAP10 NM_000942.4  
GGCCTGTGGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTTGCCGCCGCCCTC
HKR395378 RBd88H10 pGCAP10 NM_000942.4  
GGTTTTTGCATCCTGCGCCCCCCCAAACCCCACGTGACGGTGCTCCTTCCCCCCACCCTC
HKR395725 RBd89F05 pGCAP10 NM_000942.4  
GAGCTGTCCGGGCTGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACAT
HKR403119 RBdS007N07 pGCAP10 NM_000942.4  
GGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTT
HKR430078 RBdS075D06 pGCAP10 NM_000942.4  
GCTGTGGATGCTGCGCCTCTCCGAACGCAACATGAAGGTGCTCCTTGCCGCCGCCCTCAT
HKR474984 RBdS187H16 pGCAP10 NM_000942.4  
GAGCTGTCCGGGCTGCTTTCGCCTCCGCCTGTGGATGCTGCGCCTCTCCGAACGCAACAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl