Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00525

HP ID(1) HP00525
Gene ID(2) 7386
Gene Symbol finder UQCRFS1
Protein Name ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1
RefSeq NM_006003.2
Length of RefSeq (bp) 1224
Chromosome 19q12-q13.1
Reference DDBJ accession
UniGene Hs.170107

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe45H04 pKA1U5 GCCCCTGATGAACCGGCTTGGCGGTTGGAGCGGCTGTCGCCATGNTTGTCGGTAGCAGCC
ARe64B02 pKA1U5 AANCCNGGGNGAACGGCTAGGCGGTTGGAGCGGCNTGTCGCCATGNTTGTCGGTAGCAGC
ARe98B05 pKA1U5 ATGTTGTCGGTAGCAGCCCGCTCGGGCCCGATTCGCGCCCGTCCTGTCGGCCACGATCCC
ARi08G06 pGCAP10 GGTCGCCATGTTGTCGGTAGCAGCCCGCTCGGGCCCGTTCGCGCCCGTCCTGTCGGCCAC
ARiS087K14 pGCAP10 GGGCTTGGCGGTTGGAGCGGCTGTCGCCATGTTGTCGGTAGCAGCCCGCTCGGGCCCGTT
ARiS087P02 pGCAP10
RBd29B11 pGCAP10 GCCCTGTGACCGGCTTGGCGGTTGGAGCGGCTGTCGCCATGTTGTCGGTAGCAGCCCGCT
RBdS015H17 pGCAP10 GGGTTGGAGCGGCTGTCGCCATGTTGTCGGTAGCAGCCCGCTCGGGCCCGTTCGCGCCCG
RBdS132C02 pGCAP10 TGGTCGCCATGTTGTCGGTAGCAGCCCGCTCGGGCCCGTTCGCGCCCGTCCTGTCGGCCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl