Prev. |  KEGG KO K00411 > 

RIKEN DNA Bank Human Resource - UQCRFS1

Gene ID NCBI Gene 7386 |  KEGG hsa:7386
Gene Symbol UQCRFS1
Protein Name ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1
Synonyms RIP1|RIS1|RISP|UQCR5
Ortholog resources KEGG ortholog (KEGG orthology K00411) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067246 IRAK168B22 pBluescriptR BC067832 NM_006003 Full/var
HGY082237 IRAL005J21 pOTB7 BC000649 NM_006003 Full
HGY090903 IRAL027E07 pOTB7 BC010035 NM_006003 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR058172 ARe45H04 pKA1U5 NM_006003.2  
GCCCCTGATGAACCGGCTTGGCGGTTGGAGCGGCTGTCGCCATGNTTGTCGGTAGCAGCC
HKR065626 ARe64B02 pKA1U5 NM_006003.2  
AANCCNGGGNGAACGGCTAGGCGGTTGGAGCGGCNTGTCGCCATGNTTGTCGGTAGCAGC
HKR079229 ARe98B05 pKA1U5 NM_006003.2  
ATGTTGTCGGTAGCAGCCCGCTCGGGCCCGATTCGCGCCCGTCCTGTCGGCCACGATCCC
HKR163350 ARi08G06 pGCAP10 NM_006003.2  
GGTCGCCATGTTGTCGGTAGCAGCCCGCTCGGGCCCGTTCGCGCCCGTCCTGTCGGCCAC
HKR235054 ARiS087K14 pGCAP10 NM_006003.2  
GGGCTTGGCGGTTGGAGCGGCTGTCGCCATGTTGTCGGTAGCAGCCCGCTCGGGCCCGTT
HKR235162 ARiS087P02 pGCAP10 NM_006003.2  
HKR371635 RBd29B11 pGCAP10 NM_006003.2  
GCCCTGTGACCGGCTTGGCGGTTGGAGCGGCTGTCGCCATGTTGTCGGTAGCAGCCCGCT
HKR406185 RBdS015H17 pGCAP10 NM_006003.2  
GGGTTGGAGCGGCTGTCGCCATGTTGTCGGTAGCAGCCCGCTCGGGCCCGTTCGCGCCCG
HKR452850 RBdS132C02 pGCAP10 NM_006003.2  
TGGTCGCCATGTTGTCGGTAGCAGCCCGCTCGGGCCCGTTCGCGCCCGTCCTGTCGGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl