Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00524

HP ID(1) HP00524
Gene ID(2) 4946
Gene Symbol finder OAZ1
Protein Name ornithine decarboxylase antizyme 1
RefSeq NM_004152.2
Length of RefSeq (bp) 1146
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.446427

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe19G11 pKA1U5 ATTTTGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGGT
ARe40E10 pKA1U5 ATCCTGGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGG
ARe47G04 pKA1U5 GCTGGGCGCAGCATCTATAAAGGCGGGCGGCGGCAGAGGCGCCATTTTGCGAACGGCGAG
ARe77H03 pKA1U5 GGCCATTTTGCGAACGGCGAGCAGCGGCGGCGNCCTTNGAGAGACGCAGCGGAGGTTTTC
ARe99C04 pKA1U5 GGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGGTTTCG
ARi11E08 pGCAP10 GGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGGTTTCG
ARi21G11 pGCAP10 GGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGGTTTCG
ARi22B02 pGCAP10 GATTTTTTGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCT
ARi23H08 pGCAP10 GGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGGTTTCG
ARi33D04 pGCAP10 GGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGGTTTCG
ARi42H10 pGCAP10 GATTTTGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGG
ARi54E06 pGCAP10 GATTTTTTGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCT
ARi66H10 pGCAP10 GATTTTGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGG
ARiS013E16 pGCAP10 GGACGCCNCGGACATGGNGGCCGAGACCNGCNGNGTGGGGGACNNGGTTTNCNGCCNGNT
ARiS020G19 pGCAP10 GGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGGTTTCG
ARiS045C23 pGCAP10
ARiS087I23 pGCAP10
ARiS096J15 pGCAP10 GGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGGTTTCG
ARiS096N08 pGCAP10 GGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGGTTTCG
ARiS161O20 pGCAP10 GGCGAACGGNGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGGTTTCG
ARiS198A05 pGCAP10
RBb09D04 pKA1U5 TTTTTGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGGT
RBd07E03 pGCAP10 GGCCATTTTGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCC
RBd77B12 pGCAP10 TGGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGGTTTC
RBd82A06 pGCAP10 GATTTTGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGG
RBd93E05 pGCAP10 TTTTTTTTTGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl