Prev. |  KEGG KO K16548 > 

RIKEN DNA Bank Human Resource - OAZ1

Gene ID NCBI Gene 4946 |  KEGG hsa:4946
Gene Symbol OAZ1
Protein Name ornithine decarboxylase antizyme 1
Synonyms AZ1|AZI|OAZ
Ortholog resources KEGG ortholog (KEGG orthology K16548) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047755 ARe19G11 pKA1U5 NM_004152.2  
ATTTTGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGGT
HKR056106 ARe40E10 pKA1U5 NM_004152.2  
ATCCTGGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGG
HKR058948 ARe47G04 pKA1U5 NM_004152.2  
GCTGGGCGCAGCATCTATAAAGGCGGGCGGCGGCAGAGGCGCCATTTTGCGAACGGCGAG
HKR070971 ARe77H03 pKA1U5 NM_004152.2  
GGCCATTTTGCGAACGGCGAGCAGCGGCGGCGNCCTTNGAGAGACGCAGCGGAGGTTTTC
HKR079652 ARe99C04 pKA1U5 NM_004152.2  
GGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGGTTTCG
HKR164504 ARi11E08 pGCAP10 NM_004152.2  
GGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGGTTTCG
HKR168555 ARi21G11 pGCAP10 NM_004152.2  
GGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGGTTTCG
HKR168826 ARi22B02 pGCAP10 NM_004152.2  
GATTTTTTGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCT
HKR169376 ARi23H08 pGCAP10 NM_004152.2  
GGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGGTTTCG
HKR173276 ARi33D04 pGCAP10 NM_004152.2  
GGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGGTTTCG
HKR176978 ARi42H10 pGCAP10 NM_004152.2  
GATTTTGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGG
HKR181702 ARi54E06 pGCAP10 NM_004152.2  
GATTTTTTGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCT
HKR186578 ARi66H10 pGCAP10 NM_004152.2  
GATTTTGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGG
HKR205312 ARiS013E16 pGCAP10 NM_004152.2  
GGACGCCNCGGACATGGNGGCCGAGACCNGCNGNGTGGGGGACNNGGTTTNCNGCCNGNT
HKR208163 ARiS020G19 pGCAP10 NM_004152.2  
GGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGGTTTCG
HKR218071 ARiS045C23 pGCAP10 NM_004152.2  
HKR235015 ARiS087I23 pGCAP10 NM_004152.2  
HKR238631 ARiS096J15 pGCAP10 NM_004152.2  
GGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGGTTTCG
HKR238720 ARiS096N08 pGCAP10 NM_004152.2  
GGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGGTTTCG
HKR264756 ARiS161O20 pGCAP10 NM_004152.2  
GGCGAACGGNGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGGTTTCG
HKR279205 ARiS198A05 pGCAP10 NM_004152.2  
HKR323676 RBb09D04 pKA1U5 NM_004152.2  
TTTTTGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGGT
HKR362899 RBd07E03 pGCAP10 NM_004152.2  
GGCCATTTTGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCC
HKR390836 RBd77B12 pGCAP10 NM_004152.2  
TGGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGGTTTC
HKR392806 RBd82A06 pGCAP10 NM_004152.2  
GATTTTGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCCTGG
HKR397301 RBd93E05 pGCAP10 NM_004152.2  
TTTTTTTTTGCGAACGGCGAGCAGCGGCGGCGGCGCGGAGAGACGCAGCGGAGGTTTTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl