Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00519

HP ID(1) HP00519
Gene ID(2) 5683
Gene Symbol finder PSMA2
Protein Name proteasome (prosome, macropain) subunit, alpha type, 2
RefSeq NM_002787.4
Length of RefSeq (bp) 1466
Chromosome 7p13
Reference DDBJ accession
UniGene Hs.333786

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe06C10 pKA1U5 TGGTGTGCTTTGGCTCTTCGGGTAAAGATGGCGGAGCGCGGGTACAGCTTTTCGCTGACT
ARe39D01 pKA1U5 GGTGCTTTGGCTCTTCGGGTAAAGATGGCGGAGCGCGGGTACAGCTTTTCGCTGACTACA
ARe51E09 pKA1U5 TGGGGCTCTTCGGGTAAAGATGGCGGAGCGCGGGTACAGCTTTTCGCTGACTACATTCAG
ARe91A04 pKA1U5 GGGCTCTTCGGGTAAAGATGGCGGAGCGCGGGTACAGCTTTTCGCTGACTACATTCAGCC
ARi25C08 pGCAP10 GGGCTCTTCGGGTAAAGATGGCGGAGCGCGGGTACAGCTTTTCGCTGACTACATTCAGCC
ARiS118G02 pGCAP10 GTCTTCGGGTAAAGATGGCGGAGCGCGGGTACAGCTTTTCGCTGACTACATTCAGCCCGT
ARiS150I09 pGCAP10 GTCTTCGGGTAAAGATGGCGGAGCGCGGGTACAGCTTTTCGCTGACTACATTCAGCCCGT
RBb47D06 pGCAP1 GTCTCTTCGGGTAAAGATGGCGGAGCGCGGGTACAGCTTTTCGCTGACTACATTCAGCCC
RBb55E08 pGCAP1
RBd16F12 pGCAP10 GGGCTCTTCGGGTAAAGATGGCGGAGCGCGGGTACAGCTTTTCGCTGACTACATTCAGCC
RBd65F04 pGCAP10 GNNGCTTTGGCTCTTCGGGTAAAGATGGCGGACCGCGGGTACAGCTTTTCGCTGACTACN
RBd81E03 pGCAP10 GGTGCTTTGGCTCTTCGGGTAAAGATGGCGGAGCGCGGGTACAGCTTTTCGCTGACTACA
RBd85D05 pGCAP10 GTCTTCGGGTAAAGATGGCGGAGCGCGGGTACAGCTTTTCGCTGACTACATTCAGCCCGT
RBd87F01 pGCAP10 GGGCTCTTCGGGTAAAGATGGCGGAGCGCGGGTACAGCTTTTCGCTGACTACATTCAGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl